Sequence of DPV Sesame necrotic mosaic virus

Sesame necrotic mosaic virus replicase and truncated replicase genes, partial cds; coat protein gene, complete cds; and protein 4 (p4) and protein 5 (p5) genes, partial cds.

ACC No: DQ367845

Dated: 2006-02-19 | Length: 3368 | CRC: 1376604988

ID   DQ367845   standard; genomic RNA; VRL; 3368 BP.
AC   DQ367845;
SV   DQ367845.1
DT   19-FEB-2006 (Rel. 86, Created)
DT   19-FEB-2006 (Rel. 86, Last updated, Version 1)
DE   Sesame necrotic mosaic virus replicase and truncated replicase genes,
DE   partial cds; coat protein gene, complete cds; and protein 4 (p4) and
DE   protein 5 (p5) genes, partial cds.
KW   .
OS   Sesame necrotic mosaic virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Tombusviridae;
OC   Aureusvirus; unclassified Aureusvirus.
RN   [1]
RP   1-3368
RA   Yan L., Chen K., Han C.;
RT   "Partial Sequence analysis of Sesame Necrotic Mosaic Virus";
RL   Zhongguo You Liao Zuo Wu Xue Bao 24:61-66(2002).
RN   [2]
RP   1-3368
RA   Yan L., Xu Z., Chen K.;
RT   ;
RL   Submitted (16-JAN-2006) to the EMBL/GenBank/DDBJ databases.
RL   Oil Crops Research Insitute, CAAS, No 2, Xudong 2nd Road, Wuchang, Wuhan,
RL   Hubei 430062, China
FH   Key             Location/Qualifiers
FT   source          1. .3368
FT                   /country="China:Wuhan"
FT                   /db_xref="taxon:369917"
FT                   /mol_type="genomic RNA"
FT                   /virion
FT                   /organism="Sesame necrotic mosaic virus"
FT                   /serotype="Wuhan"
FT                   /isolate="Wuhan"
FT                   /specific_host="Sesame"
FT                   /lab_host="Nicotiana benthamiana"
FT                   /PCR_primers="fwd_seq: aggagatggtggtccgaact, rev_seq:
FT                   ctgtgtgccctccactacaa"
FT   CDS             <1. .1599
FT                   /codon_start=1
FT                   /note="amber stop codon readthrough"
FT                   /transl_except=(pos:49. .51,aa:OTHER)
FT                   /product="replicase"
FT                   /protein_id="ABD34316.1"
FT                   GEGHVVPTLLDHCSR"
FT   CDS             <1. .51
FT                   /codon_start=1
FT                   /product="truncated replicase"
FT                   /protein_id="ABD34317.1"
FT                   /translation="PLEAVKASYTGGFESK"
FT   CDS             1660. .2793
FT                   /codon_start=1
FT                   /product="coat protein"
FT                   /protein_id="ABD34313.1"
FT   gene            2883. .>3368
FT                   /gene="p4"
FT   CDS             2883. .>3368
FT                   /codon_start=1
FT                   /gene="p4"
FT                   /product="protein 4"
FT                   /protein_id="ABD34314.1"
FT   gene            3014. .>3368
FT                   /gene="p5"
FT   CDS             3014. .>3368
FT                   /codon_start=1
FT                   /gene="p5"
FT                   /product="protein 5"
FT                   /protein_id="ABD34315.1"
FT                   LNHPIIQGKVCYGG"
SQ   Sequence 3368 BP; 794 A; 769 C; 924 G; 881 T; 0 other;

dq367845 Length: 3368  19-FEB-2006  Type: N  Check: 9629  ..

       1  ccccttgaag ccgtcaaagc ctcctacaca gggggctttg aaagcaaata
      51  ggggtgcctt cttcgtcacc gcgggttcaa cacaaaggtc aattcatgct
     101  tacctgacaa tgtgttgtcc agccgcgagg agatggtggt ccgaactggg
     151  acccctgtgc gtaatgagcg gacatggtac tcattttctg gatacgccag
     201  cacttacgag tacattgtgc ataattcctc tctcgttaat gttgttcgtg
     251  gattggtcga gagagtgttt tgcgtcgtga gagacggcca acttcaacgt
     301  cctttacgcc cggcacttgg cgtgtatgag aagaagttgg gtaatattgg
     351  tcgtaaaatc agccggatcg ttgggtactg ccccgctatg actcgacagc
     401  agtttgtcga ctcatatagc ggcttgcgac gtgccacgta cgaaaaggcg
     451  cggttgtcct tggatgttct cccctgcact aggaaagatg cttgcctcaa
     501  aacttttgtg aaagcggaga agatcaatat tacattaaaa cccgatccag
     551  ccccgagagt tattcagcca cgtgaccctc ggtataatgt tgaagtggga
     601  cgatacttga agaatcttga accccggctt atgaaggcta ttgataaact
     651  ttggggggaa aagacagcaa ttaaggggta cactgttgag caagttggtg
     701  acattctgca ccgtaaaagc ctcgggttcc gtgatccagc tttcgttggt
     751  cttgacgcta gccgttttga tcagcactgt tcacggcaag cccttgaatg
     801  ggagcacagc gtttataatg cgatctttcg ggatccctat ttggctgagc
     851  tccttacgtg gcagattgac aatgttggcc gtgcatacct caaggatgga
     901  atggtcaagt atcgagttga cgggtgtcgg atgtctggag acatgaacac
     951  ttcaatgggc aactacctga ttatgtcgtg tcttgtctat gcgtactgcc
    1001  aggagatcgg tatccatgcc agtctagcta attgcggcga tgactgcgta
    1051  ctctttctcg agcgtgggga tctgaacaag ttgaagtccc tgcctgactg
    1101  gtttgctaag atggggtatg ctatgaaggt tgagaagcct gtgtatgcag
    1151  ttgagcatat tgaattttgc cagcagcatc cagttttgtt atccagaggg
    1201  tgggttatgg tcagaaggcc ggatgtttgt cttactaagg atgtgtgcat
    1251  cgtacggggt ggtatgacac cggagcgact ccagcggtgg ctgtatgccc
    1301  agcatgatgg cgggttatcc cttgcgggag actgtccagt gcttggtgct
    1351  ttttacagcc agtttcctgc tggtgatcgg gccggggaac aatcagagta
    1401  cgacgatgcc cataagttca aggccggtaa gcagtgtggt gctatcacgc
    1451  cgaccgcaag gtactcgttt tggatggctt tcgggctcac acccgatgag
    1501  cagattgcaa ttgaacggga cctcaaaggt tggaatcctc gcgttgagga
    1551  aggggaggga catgtggttc ctaccctcct tgaccactgc tcaagataac
    1601  tgaccattat cacctccatt tacctaacga tgactatgat cttaaagaac
    1651  aagcctatga tggctttagc agcagcaaat actggaaaga tgttagcgag
    1701  tggtggccgg attgctgatg gcaccatccg cattattgac ggaatacgtt
    1751  gtgtttacaa tgcagcttca aagatgtggc gggcgacaaa gaagcaaggc
    1801  aacggtgcca ctgttggcca tcctggggct ctcccggggg ctgttgcagc
    1851  accgattgcc atttctcgcc aaatacgagg tagcaaacct aagtttcgca
    1901  gtaccaaagg agttgtgacc atcactcacc gagagttcct cagcacggtc
    1951  caggccgtga atacaggttt tcttcgcctg aataacgggg tatcgccagg
    2001  ctactaccga attaatcctt ccaattcagc agttacacca tggcttgtca
    2051  acattgccgc caatttcgac atgtatcgct tccgtaatgt ctcgcttcgg
    2101  tatatcccaa tgtgtgcgac gacagaggtt ggccgtgtcg ggttgttctg
    2151  ggacaaggat tcccaagatg taggcccgtt tgacagagca gagttggcta
    2201  actatgcgca tgtggctgag acatcggtat gggctgaggc cgttttgaat
    2251  gtaccctgtg acgggcagaa aaggttttgt aatgattcag ccgttgccga
    2301  ccctaagctg actgaactcg ggcgtattgg atttgtcaca tatgggacta
    2351  acaccagcaa tttcattggt gatgtgttta tcgagtatac tgtggaactt
    2401  catgagccgc aaccttcctc aaacctagtt gctgagcttc tggggactgg
    2451  gggcactttc tctgcagcaa gaggttcaaa cgtcatcgag tggcggagtg
    2501  acacgagctc cgcctcagtt gtgtcaatta cgtttaaacc aggcacttat
    2551  cttgttcagt gtgtatttga tgggactact gtgactggag catcagtcac
    2601  tgctgtcggc ggtggggctg tccttaactc caaggtagtg ttttctacta
    2651  ctgaggggtc catctctgcc accgttgaca tgtctgagcc taacaaccgt
    2701  cttgactttg gggtcacagc agccgtattg tccggatgga atgtatttgc
    2751  tacccgtatt acacgggagc tagcgttaac gattaattct taaggcatag
    2801  tcgtgtgcga aagggaggtt ggattgaggg tggggcccag gccccactgc
    2851  acttgagtgg ctcaagaaga ctgaccatct tcatggaaat tgtatctttg
    2901  gacggaacat ttgacgaatc tataagtgta caaaacgaag tgaagaaaat
    2951  agtgctttct cacagcacta caaaagccat actcccgata gcaccgaaga
    3001  gtagtttgag taaatggaga atcccgaaga gtgggtttta taccccgatc
    3051  gatgtccgtt ttgttctcac gccacatata tccgaacgag ccaatgtgat
    3101  ggcggtggta aagttagtgg acgcacgcga ctgttcgccg agccgtatct
    3151  tgtatcagac aaaggagttc aaccttggag ctgggattgt agtggagggc
    3201  acacagttac ccttctgcct tccggtgggg gaatatcctt tacagttcga
    3251  agtcacggtg tcgcggtctc aattcaggga gacgtccaag ctattcacaa
    3301  cctccaacga atggcgaatg atgtgctcaa ccaccccatt atccagggta
    3351  aggtctgtta tgggggct