Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate CT11 coat protein (p27) gene, complete cds.

ACC No: EU529133

Dated: 2008-03-31 | Length: 723 | CRC: 1976221230

ID   EU529133; SV 1; linear; genomic RNA; STD; VRL; 723 BP.
AC   EU529133;
DT   31-MAR-2008 (Rel. 95, Created)
DT   31-MAR-2008 (Rel. 95, Last updated, Version 1)
DE   Citrus tristeza virus isolate CT11 coat protein (p27) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-723
RA   Xu M., Zhou C.Y., Liu J.;
RT   ;
RL   Submitted (29-FEB-2008) to the EMBL/GenBank/DDBJ databases.
RL   Chinese Academy of Agricultural Sciences, Citrus Research Institute,
RL   Beibei, Chongqing 400712, China
FH   Key             Location/Qualifiers
FT   source          1. .723
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="CT11"
FT                   /mol_type="genomic RNA"
FT                   /PCR_primers="fwd_seq: atggccrggttayacrayrc, rev_seq:
FT                   ctacaaatacttcccaaatc"
FT                   /db_xref="taxon:12162"
FT   gene            1. .723
FT                   /gene="p27"
FT   CDS             1. .723
FT                   /codon_start=1
FT                   /gene="p27"
FT                   /product="coat protein"
FT                   /note="CTVp27"
FT                   /protein_id="ACB32274.1"
FT                   GYEEATELLNLRDLGKYL"
SQ   Sequence 723 BP; 225 A; 130 C; 160 G; 208 T; 0 other;

eu529133 Length: 723  31-MAR-2008  Type: N  Check: 392  ..

       1  atggcaggtt atacaatact tcccaaaact gatgacaaag aaatggaccc
      51  ggtgagtgcc gctgtgcccg gtaaataccc ggacgttatt gaaaagtttg
     101  tgaccaatag gtcagtagat gcgttaatag aaggtgttat tagcaagttg
     151  gatactaatt caatatacga agattccact gaaaaattta ctggtgagca
     201  attgaagtac gtcatggtta ctatggacac tttcttacta gaaaattaca
     251  aaacgaaaac ggaagatctg ctggttcact tggctatgat tcaaaagagg
     301  ttgtgcacta tatctacgag tactaaaacc aaatttcgtg ataaaggttg
     351  tatcagttac gtgcaagggg gtttacgata taagttaatg gataaagtag
     401  tttttccttt tattatatct aagtttactg acagggagac tccaaacgct
     451  ttacgtaagt atgcttgtac ttttgaggag ttacacttgt gtatggctaa
     501  gctgagaccc gacttatacg aaaacaaaag gacgaccaaa gctgggactc
     551  cccatttaaa agactactta tcagctgatt ttcttacggg ttccctccca
     601  ggatactccg aacatgaacg aggtatcatc cttcgagcgt ctgaatctat
     651  gttagctaga cgtcaaggtt acgaggaggc aaccgagctt cttaacttac
     701  gcgatttggg taagtatttg tag