Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate Keawwhan Mandarin 49 coat protein (p25) gene, partial cds.

ACC No: FJ429962

Dated: 2008-12-16 | Length: 666 | CRC: 512358716

ID   FJ429962; SV 1; linear; genomic RNA; STD; VRL; 666 BP.
AC   FJ429962;
DT   16-DEC-2008 (Rel. 98, Created)
DT   16-DEC-2008 (Rel. 98, Last updated, Version 1)
DE   Citrus tristeza virus isolate Keawwhan Mandarin 49 coat protein (p25) gene,
DE   partial cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-666
RA   Paradornuwat A., Kositratana W., Chowpongpang S.;
RT   "Cloning and sequencing of Citrus tristeza closterovirus coat protein
RT   gene";
RL   Thai J. Agric. Sci. 37:99-108(2004).
RN   [2]
RP   1-666
RA   Paradornuwat A., Kositratana W., Chowpongpang S.;
RT   ;
RL   Submitted (31-OCT-2008) to the EMBL/GenBank/DDBJ databases.
RL   Plant Pathology, Kasetsart University, Phahonyotin, Jatujak, Bangkok 10900,
RL   Thailand
FH   Key             Location/Qualifiers
FT   source          1. .666
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="Keawwhan Mandarin 49"
FT                   /serotype="Rangsit"
FT                   /mol_type="genomic RNA"
FT                   /country="Thailand"
FT                   /PCR_primers="fwd_name: CTV-Bam, fwd_seq:
FT                   ggattcgacgaaacaaagaaattgaag, rev_name: CTV-Hind, rev_seq:
FT                   aagctttcaacgtgtgttgaatttc"
FT                   /db_xref="taxon:12162"
FT   gene            <1. .666
FT                   /gene="p25"
FT   CDS             <1. .666
FT                   /codon_start=1
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="ACJ49209.1"
SQ   Sequence 666 BP; 198 A; 127 C; 165 G; 176 T; 0 other;

fj429962 Length: 666  16-DEC-2008  Type: N  Check: 2728  ..

       1  gacgaaacaa agaaattgaa gaacaaaaac aaggagacga aagaaggcga
      51  cgatgttgtt gcagctgagt cttctttcgg ttcgttaaac ttacacatcg
     101  atccgactct gatagcgatg aacgatgtgc gtcagttggg tacccaacag
     151  aatgctgctt tgaatagaga tttgtttctt accttgaaag ggaaatatcc
     201  caacttacct gacaaagata aagactttca catagctatg atgttatatc
     251  gtttagcagt taagagttca tcgttacaaa gcgacgatga taccacgggt
     301  atgacgtaca ctcgggaagg tgttgaagtg gaactgtctg acaaactttg
     351  gacagacgtc gtgtttaact ctaagggtat tggtaaccgt actaacgccc
     401  tccgagtctg gggcagatct aacgatgccc tttatttggc tttttgtaga
     451  cagaaccgca acttgagtta tggtggacgt ccgttagacg caggaattcc
     501  agccgggtat cactacctgt gtgcagattt cttgaccgga gccggcttga
     551  ctgatttaga atgtgctgtg tacatacaag ctaaagagca attattaaag
     601  aagcgagggg ctgatgaagt catagttact aatgtcaggc agcttgggaa
     651  attcaacaca cgttga