Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate Shokun Mandarin 139 coat protein (p25) gene, partial cds.

ACC No: FJ440566

Dated: 2008-12-16 | Length: 666 | CRC: 2073000707

ID   FJ440566; SV 1; linear; genomic RNA; STD; VRL; 666 BP.
AC   FJ440566;
DT   16-DEC-2008 (Rel. 98, Created)
DT   16-DEC-2008 (Rel. 98, Last updated, Version 1)
DE   Citrus tristeza virus isolate Shokun Mandarin 139 coat protein (p25) gene,
DE   partial cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-666
RA   Paradornuwat A., Kositratana W., Chowpongpang S.;
RT   "Cloning and Sequencing of Citrus Tristeza Closterovirus Coat Protein
RT   Gene";
RL   Thai J. Agric. Sci. 37:99-108(2004).
RN   [2]
RP   1-666
RA   Paradornuwat A., Kositratana W., Chowpongpang S.;
RT   ;
RL   Submitted (08-OCT-2008) to the EMBL/GenBank/DDBJ databases.
RL   Plant Pathology, Kasetsart University, Phahonyotin, Jatujak, Bangkok 10900,
RL   Thailand
FH   Key             Location/Qualifiers
FT   source          1. .666
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="Shokun Mandarin 139"
FT                   /serotype="Rangsit"
FT                   /mol_type="genomic RNA"
FT                   /country="Thailand"
FT                   /PCR_primers="fwd_name: CTV-Bam, fwd_seq:
FT                   ggattcgacgaaacaaagaaattgaag, rev_name: CTV-Hind, rev_seq:
FT                   aagctttcaacgtgtgttgaatttc"
FT                   /db_xref="taxon:12162"
FT   gene            <1. .666
FT                   /gene="p25"
FT   CDS             <1. .666
FT                   /codon_start=1
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="ACJ23473.1"
SQ   Sequence 666 BP; 198 A; 126 C; 164 G; 178 T; 0 other;

fj440566 Length: 666  16-DEC-2008  Type: N  Check: 3677  ..

       1  gacgaaacaa agaaattgaa gaacaaaaac aaggaaacga aagaaggcga
      51  cgatgttgtt gcagctgagt cttctttcgg ttccgtaaac ttacacatcg
     101  atccgactct gataacgatg aacgatgtgc gtcagttggg tacccaacag
     151  aacgctgctt tgaatagaga tttgtttctt accttgaaag ggaagtatcc
     201  taacttacct gacaaagata aagactttca catagctatg atgttatatc
     251  gtttagctgt taagagttca tcattacaaa gcgacgatga taccacgggt
     301  atgacgtaca ctcgggaagg tgttgaagtg gaattgtctg acaaactttg
     351  gacagacgtc gtgtttaact ctaagggtat tggtaaccgt actaacgccc
     401  ttcgagtctg gggtagatct aacgatgccc tttatttggc tttttgtaga
     451  cagaaccgca acttgagtta tggtggacgt ccgttagacg caggaattcc
     501  agccgggtat cactacctgt gtgcagattt cttgaccgga gccggcttga
     551  ctgatttaga atgtgctgtg tacatacaag ctaaagagca attattaaag
     601  aagcgagggg ctggtgaagt catagttacc aatgtcaggc agcttgggaa
     651  attcaacaca cgttga