Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate Keaowhan Mandarin 45 coat protein (p25) gene, partial cds.

ACC No: FJ440568

Dated: 2008-12-16 | Length: 666 | CRC: 2088664592

ID   FJ440568; SV 1; linear; genomic RNA; STD; VRL; 666 BP.
AC   FJ440568;
DT   16-DEC-2008 (Rel. 98, Created)
DT   16-DEC-2008 (Rel. 98, Last updated, Version 1)
DE   Citrus tristeza virus isolate Keaowhan Mandarin 45 coat protein (p25) gene,
DE   partial cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-666
RA   Paradornuwat A., Kositratana W., Chowpongpang S.;
RT   "Cloning and Sequencing of Citrus Tristeza Closterovirus Coat Protein
RT   Gene";
RL   Thai J. Agric. Sci. 37:99-108(2004).
RN   [2]
RP   1-666
RA   Paradornuwat A., Kositratana W., Chowpongpang S.;
RT   ;
RL   Submitted (08-OCT-2008) to the EMBL/GenBank/DDBJ databases.
RL   Plant Pathology, Kasetsart University, Phahonyotin, Jatujak, Bangkok 10900,
RL   Thailand
FH   Key             Location/Qualifiers
FT   source          1. .666
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="Keaowhan Mandarin 45"
FT                   /serotype="Rangsit"
FT                   /mol_type="genomic RNA"
FT                   /country="Thailand"
FT                   /PCR_primers="fwd_name: CTV-Bam, fwd_seq:
FT                   ggattcgacgaaacaaagaaattgaag, rev_name: CTV-Hind, rev_seq:
FT                   aagctttcaacgtgtgttgaatttc"
FT                   /db_xref="taxon:12162"
FT   gene            <1. .666
FT                   /gene="p25"
FT   CDS             <1. .666
FT                   /codon_start=1
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="ACJ23475.1"
SQ   Sequence 666 BP; 201 A; 123 C; 164 G; 178 T; 0 other;

fj440568 Length: 666  16-DEC-2008  Type: N  Check: 3768  ..

       1  gacgaaacaa agaaattgaa gaacaaaaac aaggaaacga aagaaggcga
      51  cgatgttgtt gcagctgagt cttctttcgg ttccgtaaac ttacacatcg
     101  atccgactct gatagcgatg aacgatgtgc gtcagttggg tacccaacag
     151  aatgctgctt tgaatagaga tttgtttctt accttgaaag ggaagtatcc
     201  taacttacct gacaaagata aagactttca catagccatg atgttatatc
     251  gtttagcagt taagagttca tcattacaaa gcgacgatga taccacgggt
     301  atgacgtaca ctcgggaagg tgttgaagtg gaattgtctg acaaactttg
     351  gacagacgtc gtgtttaact ctaagggtat tggtaatcgt actaacgccc
     401  ttcgagtctg gggtagaagt aacgatgccc tttatttggc tttttgtaga
     451  cagaaccgca acttgagtta tggtggacgt ccgttagacg caggaattcc
     501  agccgggtat cactacctgt gtgcagattt cttaaccgga gccggcttga
     551  ctgatttaga atgtgctgtg tacatacaag ctaaagagca attattaaag
     601  aagcgagggg ctgatgaagt catagttact aatgtcaggc agcttgggaa
     651  attcaacaca cgttga