Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate QS2

ACC No: FN552118

Dated: 2009-10-13 | Length: 672 | CRC: -935117662

ID   FN552118; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FN552118;
DT   18-SEP-2009 (Rel. 102, Created)
DT   13-OCT-2009 (Rel. 102, Last updated, Version 2)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate QS2
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Abou Kubaa R.;
RT   ;
RL   Submitted (17-SEP-2009) to the EMBL/GenBank/DDBJ databases.
RL   Abou Kubaa R., Istitutu Agronomico Mediterraneo Di Bari. via Ceglie 7.,
RL   CAP: 70010, Valenzano-Bari, N/A, ITALY.
RN   [2]
RA   Abou Kubaa R., Saponari M., El-khateeb A., Yokomi R.K., Djelouah K.;
RT   "Molecular characterisation and genomic variabilty of Citrus tristeza virus
RT   (CTV) in Apulia and Syria.";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="QS2"
FT                   /mol_type="genomic RNA"
FT                   /country="Syria:Lattakia, Hannadi nursery"
FT                   /isolation_source="mother trees block"
FT                   /collected_by="Raied Abou Kubaa"
FT                   /collection_date="20-Apr-2006"
FT                   /PCR_primers="fwd_name: T36cp-F, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: T36cp-R, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CBE70802.1"
FT                   R"
SQ   Sequence 672 BP; 190 A; 124 C; 176 G; 182 T; 0 other;

fn552118 Length: 672  13-OCT-2009  Type: N  Check: 3899  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacaat gttgttgcag cggagtcttc tttcggttct gtaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtcg gttgggtacc
     151  caacagaatg ccgctttgaa cagagatttg tttcttactt tgaaagagaa
     201  gtatcctaat ttgtctgata aagataagga ctttcactta gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tgcaaagcga tgacgacact
     301  acgggtataa cgtacactcg ggagggcgtc gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt ttaattctaa gggtatcggt aaccgtacta
     401  acgcccttcg agtctggggt aggactaacg atgcccttta tttagccttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgcccgc tagatgcagg
     501  gattccggcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagagtgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctga tgaagtcgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga