Sequence of DPV Citrus tristeza virus

Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate F361

ACC No: FN661495

Dated: 2010-01-28 | Length: 672 | CRC: 2016680550

ID   FN661495; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FN661495;
DT   21-JAN-2010 (Rel. 103, Created)
DT   28-JAN-2010 (Rel. 103, Last updated, Version 3)
DE   Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate F361
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Abou Kubaa R.;
RT   ;
RL   Submitted (20-JAN-2010) to the EMBL/GenBank/DDBJ databases.
RL   Abou Kubaa R., Dept Integrated Pest Management, Mediterranean Agronomic
RL   Institute of Bari. Via Ceglie 9, 70010 Valenzano-Bari, ITALY
RN   [2]
RA   Abou Kubaa R., Saponari M., D'Onghia A., Martelli G.;
RT   "Characterization and genomic variabilty of citrus tristeza virus (CTV)
RT   isolates recovered in Apulia and Syria.";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="F361"
FT                   /mol_type="genomic RNA"
FT                   /country="Italy:Apulia"
FT                   /collected_by="Maria Saponari"
FT                   /collection_date="22-Apr-2008"
FT                   /PCR_primers="fwd_name: T36cp+, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: T36cp-, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /protein_id="CBJ19297.1"
FT                   R"
SQ   Sequence 672 BP; 197 A; 123 C; 170 G; 182 T; 0 other;

fn661495 Length: 672  28-JAN-2010  Type: N  Check: 3270  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgtcgctg ctgagtcttc tttcggttcc gtaaacttac
     101  acatcgatcc gactctgata acgatgaacg atgtgcgtca gttgagtact
     151  caacagaatg ctgctttgaa cagggactta tttcttgctc tgaaagggaa
     201  gtatcctaac ttgcctgaca aagataagga ctttcacata gctatgatgt
     251  tataccgttt agcggttaag agttcatcat tgcaaagtga tgatgacacc
     301  acgggcataa cgtacactcg ggagggtgtt gaagtagatt tgtctgacaa
     351  actttggacc gacatcgtgt ataattctaa gggtattggt aaccgaacta
     401  acgcccttcg agtctggggt agaactaacg atgctcttta cttagccttt
     451  tgtagacaga accgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggct gggtatcatt atttgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaaaaagc gaggggctga tgaggttgta gttactaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga