Sequence of DPV Citrus tristeza virus

Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate SYR-B59

ACC No: FN667583

Dated: 2010-03-02 | Length: 672 | CRC: -1025809423

ID   FN667583; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FN667583;
DT   02-MAR-2010 (Rel. 104, Created)
DT   02-MAR-2010 (Rel. 104, Last updated, Version 1)
DE   Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate
DE   SYR-B59
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Abou Kubaa R.;
RT   ;
RL   Submitted (05-FEB-2010) to the EMBL/GenBank/DDBJ databases.
RL   Abou Kubaa R., Integrated Pest Management, Mediterranean Agronomic Institue
RL   of Bari, Via Ceglie, 9, Valenzano, 70010, ITALY.
RN   [2]
RA   Abou Kubaa R., Kumari S., Saponari M., Djeluah K., D'onghia A.M.;
RT   "Citrus tristeza virus in Syria, state of the art";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sinensis"
FT                   /isolate="SYR-B59"
FT                   /mol_type="genomic RNA"
FT                   /country="Syria:Lattakia-Video nursery"
FT                   /collected_by="Raied Abou Kubaa"
FT                   /collection_date="15-Jun-2008"
FT                   /identified_by="Raied Abou Kubaa"
FT                   /PCR_primers="fwd_name: T36CP-F, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: T36CP-R, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /protein_id="CBK19531.1"
FT                   R"
SQ   Sequence 672 BP; 190 A; 123 C; 176 G; 183 T; 0 other;

fn667583 Length: 672  02-MAR-2010  Type: N  Check: 5310  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacaat gttgttgcag cggagtcttc tttcggttct gtaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtcg gttgggtacc
     151  caacagaatg ccgctttgaa cagagatttg tttcttactt tgaaagagaa
     201  gtatcctaat ttgtctgata aagataagga ctttcactta gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tgcaaagcga tgacgacact
     301  acgggtataa cgtacactcg ggagggcgtc gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt ttaattctaa gggtatcggt aaccgtacta
     401  acgcccttcg agtctggggt aggactaacg atgcccttta tttagccttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggct gggcatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagagtgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctga tgaagtcgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga