Sequence of DPV Citrus tristeza virus

Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate Q1294.DP.cl2

ACC No: FR856890

Dated: 2011-05-31 | Length: 672 | CRC: -177667791

ID   FR856890; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR856890;
DT   31-MAY-2011 (Rel. 109, Created)
DT   31-MAY-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate
DE   Q1294.DP.cl2
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Yahiaoui D.;
RT   ;
RL   Submitted (03-MAY-2011) to the INSDC.
RL   Yahiaoui D., Integrated Pest Management, Istituto Agronomico Mediterraneo
RL   Di Bari, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Addante R.;
RT   "Monitoring of Citrus tristeza virus (CTV) air borne vectors and assessment
RT   of genetic variation of a local CTV RNA population through experimental
RT   aphid transmissions";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="Q1294.DP.cl2"
FT                   /mol_type="genomic RNA"
FT                   /country="Italy:Apulia"
FT                   /isolation_source="donor plant"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="2"
FT                   /PCR_primers="fwd_name: T36CP/FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: T36CP/RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /protein_id="CCB63184.1"
FT                   R"
SQ   Sequence 672 BP; 196 A; 124 C; 169 G; 183 T; 0 other;

fr856890 Length: 672  31-MAY-2011  Type: N  Check: 3435  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgctg ctgagtcttc tttcggttcc gtaaacttac
     101  acatcgatcc gactctgata acgatgaacg atgtgcgtca gttgagtact
     151  cgacagaatg ctgctttgaa cagggactta tttcttgctc tgaaagggaa
     201  gtatcctaac ttgcctgaca aagataagga ctttcacata cctatgatgt
     251  tataccgttt agcggttaag agttcatcat tgcaaagtga tgatgacacc
     301  acgggcataa cgtacactcg ggagggtgtt gaagtagatt tgtctgacaa
     351  actttggacc gacatcgtgt ataattctaa gggtattggt aaccgaacta
     401  acgcccttcg agtctggggt agaactaacg atgctcttta cttagccttt
     451  tgtagacaga accgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggct gggtatcatt atttgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaaaaagc gaggggctga tgaggttgta gttactgatg tcacgcagct
     651  tgagaaattc aacacacgtt ga