Sequence of DPV Citrus tristeza virus

Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate Q1294.A.s.cl3

ACC No: FR856898

Dated: 2011-05-31 | Length: 672 | CRC: 271955069

ID   FR856898; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR856898;
DT   31-MAY-2011 (Rel. 109, Created)
DT   31-MAY-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus CP gene for coat protein, genomic RNA, isolate
DE   Q1294.A.s.cl3
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Yahiaoui D.;
RT   ;
RL   Submitted (03-MAY-2011) to the INSDC.
RL   Yahiaoui D., Integrated Pest Management, Istituto Agronomico Mediterraneo
RL   Di Bari, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Addante R.;
RT   "Monitoring of Citrus tristeza virus (CTV) air borne vectors and assessment
RT   of genetic variation of a local CTV RNA population through experimental
RT   aphid transmissions";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /isolate="Q1294.A.s.cl3"
FT                   /mol_type="genomic RNA"
FT                   /country="Italy:Apulia"
FT                   /isolation_source="sub-isolate after transmission by Aphis
FT                   spiraecola"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="3"
FT                   /PCR_primers="fwd_name: T36CP/FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: T36CP/RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /protein_id="CCB63192.1"
FT                   R"
SQ   Sequence 672 BP; 198 A; 124 C; 168 G; 182 T; 0 other;

fr856898 Length: 672  31-MAY-2011  Type: N  Check: 2355  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aagcgacgat gttgttgctg ctgagtcttc tttcggttcc gtaaacttac
     101  acatcgatcc gactctgata acgatgaacg atgtgcgtca gttgagtact
     151  caacagaatg ctgctttgaa cagggactta tttcttgctc tgaaagggaa
     201  gtatcctaac ttgcctgaca aagataagga ctttcacata gctatgatgt
     251  tataccgttt agcggttaag agttcatcat tgcaaagtga tgatgacacc
     301  acgggcataa cgtacactcg ggagggtgtt gaagtagatt tgtctgacaa
     351  actttggacc gacatcgtgt ataattctaa gggtattggt aaccgaacta
     401  acgcccttcg agtctggggt agaactaacg atgctcctta cttagccttt
     451  tttagacaga accgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gactccggct gggtatcatt atttgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaaaaagc gaggggctga tgaggttgta gttactaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga