Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q96, clone 6

ACC No: FR871859

Dated: 2011-06-26 | Length: 672 | CRC: -1801074071

ID   FR871859; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871859;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q96, clone 6
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q96"
FT                   /mol_type="genomic RNA"
FT                   /country="Croatia"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="2005"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="6"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84722.1"
FT                   R"
SQ   Sequence 672 BP; 197 A; 130 C; 166 G; 179 T; 0 other;

fr871859 Length: 672  26-JUN-2011  Type: N  Check: 484  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgctg ctgagtcttc tttcggttcc ttaaacttac
     101  acatcgatcc aactctgata acgatgaatg acgtgcgtca gttgagtacc
     151  caacaggacg ctgctttaaa cagagacttg tttcttactt tgaaagggaa
     201  gtatcctaac ttacctgaca aagataagga ctttcacata gctttgatgt
     251  tgtatcgttt agcagttaag agttcatcat tacaaagcga tgacgacact
     301  acgggcataa cgtacactcg ggagggtgtt gaagtggatt tgtccgacaa
     351  actttggact gacgtcgtgt ttaactccaa gggtattggc aaccgtacta
     401  acgcccttcg agtttggggt agaactaacg atgcccttta cttagctttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccgacc gggtaccatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctga tgaagtcgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga