Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q106, clone 8

ACC No: FR871864

Dated: 2011-06-26 | Length: 672 | CRC: 11239710

ID   FR871864; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871864;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q106, clone 8
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q106"
FT                   /mol_type="genomic RNA"
FT                   /country="Serbia and Montenegro"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="2005"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="8"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84727.1"
FT                   R"
SQ   Sequence 672 BP; 197 A; 129 C; 168 G; 178 T; 0 other;

fr871864 Length: 672  26-JUN-2011  Type: N  Check: 141  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgagaga
      51  aggtgacgat gttgttgctg ctgagtcttc tttcggctcc ttaaacttac
     101  acatcgatcc aactctgata acgatgaatg acgtgcgtca gttgagtacc
     151  caacggaacg ctgcattaaa cagagacttg tttcttactt tgaaagggaa
     201  gtatcctaac ttacctgaca aagataagga ctttcacata gctatgatgt
     251  tgtatcgttt agcagttaag agttcatcgt tacaaagcga tgacgacact
     301  acgggcataa catacactcg ggagggtgtt gaagtggatt tgtccgataa
     351  actttggact gacgtcgtgc ttaactccaa gggtattggc aaccgtacta
     401  acgcccttcg agtttggggt agaactaacg atgcccttta cttagctttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggcc gggtaccatt acttgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctga tgaagtcgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga