Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q109, clone 1

ACC No: FR871866

Dated: 2011-06-26 | Length: 672 | CRC: -738979656

ID   FR871866; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871866;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q109, clone 1
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q109"
FT                   /mol_type="genomic RNA"
FT                   /country="Serbia and Montenegro"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="2005"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="1"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84729.1"
FT                   R"
SQ   Sequence 672 BP; 204 A; 127 C; 162 G; 179 T; 0 other;

fr871866 Length: 672  26-JUN-2011  Type: N  Check: 1700  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaataagg aaacgaaaga
      51  aggcgatgac gttgttgccg ctgaatcttc tttcggtacc ataaacttac
     101  acatcgatcc aactctgata gcgatgaatg acgtgcgtca gttgggtacc
     151  caacagaacg ctgctttaaa tagagactta tttcttactt tgaaagggaa
     201  gcatcctaac ttacctgaca aagataagga ctttcacata gctatgatgt
     251  tgtatcgttt agcagttaaa agttcatcat tacaaagcga tgacgacact
     301  acgggtataa cgtacactcg ggagggtgtt gaagtggatt tgcctgacaa
     351  actttggact gacgtcgtgt ttaactccaa gggtattggc aaccgtacta
     401  acgcccttcg agtttggggt agaactaacg atgcccttta cttagctttt
     451  tgtagacaga atcgcaactt aagttatggc ggacgtccgt tagatgcagg
     501  gattccagcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggagctga tgaagttgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga