Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q93, clone 1

ACC No: FR871872

Dated: 2011-06-26 | Length: 672 | CRC: -1164415621

ID   FR871872; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871872;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q93, clone 1
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q93"
FT                   /mol_type="genomic RNA"
FT                   /country="Albania"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="2000"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="1"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84735.1"
FT                   R"
SQ   Sequence 672 BP; 199 A; 127 C; 167 G; 179 T; 0 other;

fr871872 Length: 672  26-JUN-2011  Type: N  Check: 8724  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacaaaaga
      51  aggcgacgat gttgttgctg ccgagtcttc tttcagttcc gtaaacttac
     101  acatcgatcc gactttgata acgatgaacg atgtgcgtca gttgagtacc
     151  caacagaacg ctgctttgaa cagagactta ttccttactt tgaaagggaa
     201  gcatcctaac ttacctgata aagataagga ctttcacata gctatgatgt
     251  tgtatcgttt agcagttaag agttcatcac tacaaagcga tgacgacgcc
     301  acgggtataa cgtacactcg ggagggtgtt gaagtggaat tgtctgacaa
     351  actttggact gacgtcgtgt ttaactctaa gggtatcggt aaccgtacta
     401  acgcccttcg agtttggggt agaactaacg atgcccttta cttagctttt
     451  tgcagacaga atcgcaattt gagttatggc ggacgtccgc tagacgcagg
     501  gattccggcc gggtatcatt acttgtgtgc ggatttcttg actggagctg
     551  gtttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaatta
     601  ttgaagaagc gaggggctga tgaagtcgta gttactaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga