Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q57, clone 1

ACC No: FR871875

Dated: 2011-06-26 | Length: 672 | CRC: 1968634258

ID   FR871875; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871875;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q57, clone 1
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q57"
FT                   /mol_type="genomic RNA"
FT                   /country="Egypt"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="2001"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="1"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84738.1"
FT                   R"
SQ   Sequence 672 BP; 192 A; 121 C; 175 G; 184 T; 0 other;

fr871875 Length: 672  26-JUN-2011  Type: N  Check: 5117  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg agacgaaaga
      51  aggcgacgat gttgttgcag cagagtcttc tttcggttcc gcgaatttac
     101  acatcgatcc gactctgata acgatgaacg atgtgcgtca gttgggaacc
     151  caacagaacg ctgctttgaa cagagatttg tttcttactc tgaaatggaa
     201  gtatcctagc ttgtctgaca aggataagga cttccacata gctatgatgt
     251  tatatcgttt agcggttaag agttcatcgt tgcaaagtga tgatgacacc
     301  acgggcataa catatactcg ggagggtgtt gaagtggatt tgtctgacaa
     351  gctttggact gacgtcgtgt ttaactctaa gggtattggt aaccgtacta
     401  atgcccttcg agtctggggt aggactaacg atgcccttta tttagctttc
     451  tgtagacaga atcgcaattt gagttatggt ggacgtccgc tagatgcagg
     501  gattccggct gggtatcatt acctatgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa ggaacaatta
     601  ttaaagaagc gaggggctga tgaagtcgta gttactaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga