Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q75, clone 16

ACC No: FR871880

Dated: 2011-06-26 | Length: 672 | CRC: -1575344330

ID   FR871880; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871880;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q75, clone 16
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q75"
FT                   /mol_type="genomic RNA"
FT                   /country="Morocco"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="2005"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="16"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84743.1"
FT                   R"
SQ   Sequence 672 BP; 200 A; 125 C; 168 G; 179 T; 0 other;

fr871880 Length: 672  26-JUN-2011  Type: N  Check: 1794  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgctg ctgagtcttc tttcggttcc gtaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtca gttgggtacc
     151  caacagaatg ctgctttgaa tagagatttg tttcttacct tgaaagggaa
     201  gtatcctaac ttacctgaca aagataaaga ctttcactta gctatgatgt
     251  tatatcgttt agcagttaag agttcatcat tacaaagcga cgatgatacc
     301  acgggtgtga cgtacactcg ggaaggtgtt gaagtggaat tgtctgacaa
     351  actttggaca gacatcgtgt ttaactctaa gggtatcggt aaccgtacta
     401  acgcccttcg agtctggggt agaactaacg atgcccttta tttggctttt
     451  tgtagacaga accgcaactt gagttatggt ggacgtccgt tagatgcagg
     501  aattccagcc gggtatcact acctgtgtgc agatttcttg accggagctg
     551  ggttgactga tttagaatgt gcagtgtaca tacaagctaa agagcaatta
     601  ctaaaaaagc gaggggctga tgaggtcgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga