Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q52, clone 1

ACC No: FR871882

Dated: 2011-06-26 | Length: 672 | CRC: -2064542679

ID   FR871882; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871882;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q52, clone 1
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q52"
FT                   /mol_type="genomic RNA"
FT                   /country="Gaza Strip"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="1999"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="1"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84745.1"
FT                   R"
SQ   Sequence 672 BP; 189 A; 124 C; 176 G; 183 T; 0 other;

fr871882 Length: 672  26-JUN-2011  Type: N  Check: 4581  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacaat gttgttgcag cggagtcttc tttcggttct gtaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtcg gttgggtacc
     151  caacagaatg ccgctttgaa cagagatttg tttcttactt tgaaagagaa
     201  gtatcctaat ttgtctgata aagataagga ctttcactta gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tgcaaagcga tgacgacact
     301  acgggtataa cgtacactcg ggagggcgtc gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt ttaattctaa gggtatcggt aaccgtacta
     401  acgcccttcg agtctggggt aggactaacg atgcccttta tttagccttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagagtgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctgc tcgagtcgta gttaccaatg tcaggaagct
     651  tgggaaattc aacacacgtt ga