Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q32, clone 1

ACC No: FR871888

Dated: 2011-06-26 | Length: 672 | CRC: -230173462

ID   FR871888; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871888;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q32, clone 1
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q32"
FT                   /mol_type="genomic RNA"
FT                   /country="Italy"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="1998"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="1"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84751.1"
FT                   R"
SQ   Sequence 672 BP; 200 A; 123 C; 168 G; 181 T; 0 other;

fr871888 Length: 672  26-JUN-2011  Type: N  Check: 3041  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgcag ctgagtcttc tttcggttcc gtaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtccgtca gttgggtacc
     151  caacagaatg ctgctttgaa tagagatttg tttcttacct tgaaagggaa
     201  gtatcctaac ttacctgaca aagataaaga ctttcactta gctatgatgt
     251  tatatcgttt agcagttaag agttcatcat tacaaagcga cgatgatacc
     301  acgggtgtga cgtacactcg ggaaggtgtt gaagtggaat tgtctgacaa
     351  actttggaca gacgtcgtgt ttaactctaa gggtattggt aaccgtacta
     401  acgcccttcg agtctggggt agaactaacg atgcccttta tttggctttt
     451  tgtagacaga accgcaactt gagttatggt ggacgtccgt tagatgcagg
     501  aattccagcc gggtatcact acctgtgtgc agatttcttg accggagctg
     551  gattgactga tttagaatgt gcagtgtaca tacaagctaa agagcaatta
     601  ttaaagaagc gaggggctga tgaggtcgta gttactaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga