Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate MAIB_Q32, clone 3

ACC No: FR871890

Dated: 2011-06-26 | Length: 672 | CRC: -2024159706

ID   FR871890; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871890;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate
DE   MAIB_Q32, clone 3
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="MAIB_Q32"
FT                   /mol_type="genomic RNA"
FT                   /country="Italy"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="1998"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="3"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84753.1"
FT                   R"
SQ   Sequence 672 BP; 190 A; 122 C; 176 G; 184 T; 0 other;

fr871890 Length: 672  26-JUN-2011  Type: N  Check: 5193  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacaat gttgttgcag cggagtcttc tttcggttct gtaaacttac
     101  acatcgatcc gactctgata acgatgaacg atgtgcgtca gttgggtacc
     151  caacagaatg ccgctttgaa cagagatttg tttcttactt tgaaagggaa
     201  gtatcctaat ttgtctgata aagataagga ctttcacata gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tgcaaagtga tgacgacact
     301  acgggtataa cgtacactcg ggagggcgtc gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt ttaattctaa gggtatcggt aaccgtgcta
     401  acgcccttcg agtctggggt aggactaacg atgcccttta tttagccttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagagtgt gctgtgtaca tacaagctaa agtacaattg
     601  ttgaagaagc gaggggctga tgaggtcgta gttaccaatg tcaggcaact
     651  tgggaaattc aacacacgtt ga