Sequence of DPV Citrus tristeza virus

Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate SG29, clone 1

ACC No: FR871892

Dated: 2011-06-26 | Length: 672 | CRC: 323397045

ID   FR871892; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   FR871892;
DT   26-JUN-2011 (Rel. 109, Created)
DT   26-JUN-2011 (Rel. 109, Last updated, Version 1)
DE   Citrus tristeza virus p25 gene for coat protein, genomic RNA, isolate SG29,
DE   clone 1
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RT   ;
RL   Submitted (24-MAY-2011) to the INSDC.
RL   Yahiaoui D., Istituto Agronomico Mediterraneo Di Bari, Integrated Pest
RL   Management, Via Ceglie, 9, 70010, ITALY.
RN   [2]
RA   Yahiaoui D., Djelouah K., D'Onghia A., Catara A.;
RT   "Genetic marker analysis of Mediterranean Citrus Tristeza Virus (CTV) RNA
RT   populations";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /host="Citrus sp."
FT                   /isolate="SG29"
FT                   /mol_type="genomic RNA"
FT                   /country="Italy"
FT                   /collected_by="Mediterranean Agronomic Institute of Bari"
FT                   /collection_date="2008"
FT                   /identified_by="Yahiaoui Dorsaf"
FT                   /clone="1"
FT                   /PCR_primers="fwd_name: CTV-CP-FW, fwd_seq:
FT                   atggacgacgaaacaaagaaattg, rev_name: CTV-CP-RV, rev_seq:
FT                   tcaacgtgtgttgaatttccca"
FT                   /db_xref="taxon:12162"
FT   CDS             1. .672
FT                   /gene="p25"
FT                   /product="coat protein"
FT                   /protein_id="CCB84755.1"
FT                   R"
SQ   Sequence 672 BP; 191 A; 129 C; 176 G; 176 T; 0 other;

fr871892 Length: 672  26-JUN-2011  Type: N  Check: 9939  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aagcgaaaga
      51  aggggacgat gttgttgcag cggagtcttc tttcggttcc ttaaacttcc
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtca gttaagtacc
     151  caacagaacg ccgctttgaa cagagatttg ttccttactt tgaaagggaa
     201  gtatcctaat ttgtctgata aagacaaaga ctttcactta gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tgcaaagtga cgacgacacc
     301  acgggcataa cgtacactcg ggagggcgtc gaagtggact tgtctgacaa
     351  actttggact gacgtcgtgt ttaattctaa gggtatcggt aaccgtacta
     401  acgcccttcg ggtctggggt agaagtaacg acgcccttta tttagcgttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc ggggggctga tgaaatcgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga