Sequence of DPV Citrus tristeza virus

Citrus tristeza virus clone C8 P20 gene, complete cds.

ACC No: HQ267970

Dated: 2011-03-20 | Length: 557 | CRC: -658058808

ID   HQ267970; SV 1; linear; genomic RNA; STD; VRL; 557 BP.
AC   HQ267970;
DT   20-MAR-2011 (Rel. 108, Created)
DT   20-MAR-2011 (Rel. 108, Last updated, Version 1)
DE   Citrus tristeza virus clone C8 P20 gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-557
RA   Amin H.A.;
RT   "Characterization and nucletide sequencing of an Egyptian isolate of Citrus
RT   tristeza isolate";
RL   Unpublished.
RN   [2]
RP   1-557
RA   Amin H.A.;
RT   ;
RL   Submitted (17-SEP-2010) to the EMBL/GenBank/DDBJ databases.
RL   Virus, Plant Pathology Institute, 9 Gamaa St., Giza, Egypt
FH   Key             Location/Qualifiers
FT   source          1. .557
FT                   /organism="Citrus tristeza virus"
FT                   /host="navel orange"
FT                   /isolate="El-Kanater-KO"
FT                   /mol_type="genomic RNA"
FT                   /country="Egypt"
FT                   /clone="C8"
FT                   /PCR_primers="fwd_seq: acaatatgcgagcttacttta, rev_seq:
FT                   tccatcttgcgtgtaggtt"
FT                   /db_xref="taxon:12162"
FT   CDS             6. .554
FT                   /codon_start=1
FT                   /product="P20"
FT                   /protein_id="ADZ53032.1"
SQ   Sequence 557 BP; 145 A; 111 C; 134 G; 167 T; 0 other;

hq267970 Length: 557  20-MAR-2011  Type: N  Check: 2297  ..

       1  acaatatgcg agcttacttt agtgttaacg attacataag ccttttggct
      51  aaggtcggcg cagttgtgga acgtttgtgc gatcccagcg taactctcac
     101  ggaagtgatg gacgaaatta atgattttaa ctcgtttctc gctttagtac
     151  actctatgaa gtcagacatg aacggtgatc atcaggatgg tcaccatgag
     201  atgggtgagc acaaatctcg attgttgtgc aatatagagg cgaaactgcg
     251  aatacttctc gacatcataa gacgtcggtt tactcgcgac aagctgctct
     301  gtaccagcgc aacagacgtg atgggcttct tcgttatgag gtacatggtt
     351  tctagtcaca tcagttttga atccgtaatg cgaacggagc tgaaattagt
     401  agttaaagca gtactatcgg atttatcccg cgcgcataaa ctagatttta
     451  gcgagcgagc ctttgcggct tacggtatcc ttttacaaaa aggtactgta
     501  gcgaccgttt gtggtcagtt tgacattaat ttagtttctc catcttgcgt
     551  gtaggtt