Sequence of DPV Cucumber mosaic virus satellite RNA

Cucumber mosaic virus satellite RNA isolate IR-WI, complete sequence.

ACC No: JF834526

Dated: 2012-02-24 | Length: 339 | CRC: -1987600954

                
ID   JF834526; SV 1; linear; genomic RNA; STD; VRL; 339 BP.
XX
AC   JF834526;
XX
DT   18-SEP-2011 (Rel. 110, Created)
DT   24-FEB-2012 (Rel. 111, Last updated, Version 3)
XX
DE   Cucumber mosaic virus satellite RNA isolate IR-WI, complete sequence.
XX
KW   .
XX
OS   Cucumber mosaic virus satellite RNA
OC   Viruses; Satellites; Satellite Nucleic Acids;
OC   Single stranded RNA satellites;
OC   Small linear single stranded RNA satellites.
XX
RN   [1]
RP   1-339
RX   PUBMED; 22038072.
RA   Nouri S., Falk B.W., Groves R.L.;
RT   "A new satellite RNA is associated with natural infections of cucumber
RT   mosaic virus in succulent snap bean";
RL   Arch. Virol. 157(2):375-377(2012).
XX
RN   [2]
RP   1-339
RA   Nouri S.;
RT   ;
RL   Submitted (24-APR-2011) to the INSDC.
RL   Plant Pathology, University of Wisconsin-Madison, 537 Russell Labs., 1630
RL   Linden Dr., Madison, WI 53706, USA
XX
FH   Key             Location/Qualifiers
FH
FT   source          1. .339
FT                   /organism="Cucumber mosaic virus satellite RNA"
FT                   /host="snap bean"
FT                   /isolate="IR-WI"
FT                   /mol_type="genomic RNA"
FT                   /country="USA"
FT                   /collection_date="2010"
FT                   /PCR_primers="fwd_name: satf, fwd_seq:
FT                   gggaattcatttaggtgacactatagttttgtttg, rev_name: satr,
FT                   rev_seq: ggggtctagacccgggtcctg"
FT                   /db_xref="taxon:12436"
XX
SQ   Sequence 339 BP; 70 A; 87 C; 94 G; 88 T; 0 other;

jf834526 Length: 339  24-FEB-2012  Type: N  Check: 1033  ..

       1  gttttgtttg ttagagaatt gcgtagaggg gttgtatcta cgtgaggatc
      51  tatcactcgg cggtgtgggt tacctccctg ctacggcggg ttgagttgac
     101  gcacctcgga ctggggaccg ctggcctgag ggctatgtcc gctactctca
     151  gcactgcgct ctcatttgag cccccgctca gtttgctagc aaaacccggc
     201  ccatggtttg ccgttaccgt ggaaatttcg aaagaaacac tctgttaggt
     251  ggtatcgtgg atgacgcaca cagggagaag ctaaaaccta tatggtcatg
     301  ctgatctccg cgtatgtaca tcataccctc acaggaccc