Sequence of DPV Cucumber mosaic virus satellite RNA
Cucumber mosaic virus satellite RNA isolate IR-WI, complete sequence.
ACC No: JF834526
Dated: 2012-02-24 | Length: 339 | CRC: -1987600954
ID JF834526; SV 1; linear; genomic RNA; STD; VRL; 339 BP. XX AC JF834526; XX DT 18-SEP-2011 (Rel. 110, Created) DT 24-FEB-2012 (Rel. 111, Last updated, Version 3) XX DE Cucumber mosaic virus satellite RNA isolate IR-WI, complete sequence. XX KW . XX OS Cucumber mosaic virus satellite RNA OC Viruses; Satellites; Satellite Nucleic Acids; OC Single stranded RNA satellites; OC Small linear single stranded RNA satellites. XX RN [1] RP 1-339 RX PUBMED; 22038072. RA Nouri S., Falk B.W., Groves R.L.; RT "A new satellite RNA is associated with natural infections of cucumber RT mosaic virus in succulent snap bean"; RL Arch. Virol. 157(2):375-377(2012). XX RN [2] RP 1-339 RA Nouri S.; RT ; RL Submitted (24-APR-2011) to the INSDC. RL Plant Pathology, University of Wisconsin-Madison, 537 Russell Labs., 1630 RL Linden Dr., Madison, WI 53706, USA XX FH Key Location/Qualifiers FH FT source 1. .339 FT /organism="Cucumber mosaic virus satellite RNA" FT /host="snap bean" FT /isolate="IR-WI" FT /mol_type="genomic RNA" FT /country="USA" FT /collection_date="2010" FT /PCR_primers="fwd_name: satf, fwd_seq: FT gggaattcatttaggtgacactatagttttgtttg, rev_name: satr, FT rev_seq: ggggtctagacccgggtcctg" FT /db_xref="taxon:12436" XX SQ Sequence 339 BP; 70 A; 87 C; 94 G; 88 T; 0 other; jf834526 Length: 339 24-FEB-2012 Type: N Check: 1033 .. 1 gttttgtttg ttagagaatt gcgtagaggg gttgtatcta cgtgaggatc 51 tatcactcgg cggtgtgggt tacctccctg ctacggcggg ttgagttgac 101 gcacctcgga ctggggaccg ctggcctgag ggctatgtcc gctactctca 151 gcactgcgct ctcatttgag cccccgctca gtttgctagc aaaacccggc 201 ccatggtttg ccgttaccgt ggaaatttcg aaagaaacac tctgttaggt 251 ggtatcgtgg atgacgcaca cagggagaag ctaaaaccta tatggtcatg 301 ctgatctccg cgtatgtaca tcataccctc acaggaccc