Sequence of DPV Beet black scorch virus

Beet black scorch virus isolate Xinjiang variant m294, complete genome.

ACC No: JN635330

Dated: 2012-11-22 | Length: 3644 | CRC: 1464465196

ID   JN635330; SV 1; linear; genomic RNA; STD; VRL; 3644 BP.
AC   JN635330;
DT   07-NOV-2011 (Rel. 110, Created)
DT   22-NOV-2012 (Rel. 114, Last updated, Version 2)
DE   Beet black scorch virus isolate Xinjiang variant m294, complete genome.
KW   .
OS   Beet black scorch virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Tombusviridae;
OC   Necrovirus.
RN   [1]
RP   1-3644
RX   PUBMED; 22971822.
RA   Xu J., Wang X., Shi L., Zhou Y., Li D., Han C., Zhang Z., Yu J.;
RT   "Two distinct sites are essential for virulent infection and support of
RT   variant satellite RNA replication in spontaneous beet black scorch virus
RT   variants";
RL   J. Gen. Virol. 93(PT 12):2718-2728(2012).
RN   [2]
RP   1-3644
RA   Xu J., Wang X., Han C., Li D., Yu J.;
RT   ;
RL   Submitted (01-SEP-2011) to the INSDC.
RL   State Key Lab. for Agrobiotech., China Agricultural University, 2
RL   YuanMingyuan Western Road, Beijing 100193, China
FH   Key             Location/Qualifiers
FT   source          1. .3644
FT                   /organism="Beet black scorch virus"
FT                   /host="sugar beet"
FT                   /lab_host="Nicotiana benthamiana"
FT                   /isolate="Xinjiang variant m294"
FT                   /mol_type="genomic RNA"
FT                   /country="China"
FT                   /collection_date="16-Apr-2009"
FT                   /PCR_primers="fwd_name: bb-421, fwd_seq:
FT                   tgtaatacgactcactatagaagaaacctaaccagtttct, rev_name: bb-412,
FT                   rev_seq: cccgggcacctggaagaccagg"
FT                   /note="variant obtained after passage propagation on N.
FT                   benthamiana in greenhouse"
FT                   /db_xref="taxon:196375"
FT   CDS             36. .2210
FT                   /codon_start=1
FT                   /transl_except=(pos:645. .647,aa:OTHER)
FT                   /product="82K protein"
FT                   /note="RNA polymerase; ORF2; translational readthrough of
FT                   ORF1"
FT                   /protein_id="AER58239.1"
FT   CDS             36. .647
FT                   /codon_start=1
FT                   /product="23K protein"
FT                   /note="RNA polymerase; ORF1"
FT                   /protein_id="AER58240.1"
FT   CDS             2228. .2419
FT                   /codon_start=1
FT                   /product="7K protein A"
FT                   /note="ORF3"
FT                   /protein_id="AER58241.1"
FT                   VSMTVVGENVEFTQHFHF"
FT   CDS             2421. .2618
FT                   /codon_start=1
FT                   /product="7K protein B"
FT                   /note="ORF4"
FT                   /protein_id="AER58242.1"
FT   CDS             2434. .2577
FT                   /codon_start=1
FT                   /product="5'K protein"
FT                   /note="ORF5"
FT                   /protein_id="AER58243.1"
FT                   NT"
FT   CDS             2647. .3345
FT                   /codon_start=1
FT                   /product="coat protein"
FT                   /note="virus shell; ORF6"
FT                   /protein_id="AER58244.1"
FT                   LIEPIPAAIN"
SQ   Sequence 3644 BP; 903 A; 865 C; 940 G; 936 T; 0 other;

jn635330 Length: 3644  22-NOV-2012  Type: N  Check: 8915  ..

       1  aagaaaccta accagtttct cgttgatcag tgatcatgga ttcaatcccg
      51  tatgtgatcc tgcgcatact cgattttatc ttccactcca tcttctttcc
     101  atccttactc ttcatcatca accacaacac caccatcctg tgggcatgcg
     151  cttgtgccta tgggttctac cgtgcattcc gcctcatctt caagataaag
     201  gtggaagtac acccagccac ccgagccgtc ttcaaggaca tggttactcg
     251  cttccagcgg gagagtatgt tctcacctga cgacgaagtg ccggagggca
     301  tccctattca cgaggatgtt gaccttgtta gcgaccccac acacaaagat
     351  attaagcggg tccgtgctag caggcgagtc tcttatgccg tgagggtagc
     401  ccatgtagcc aagtctaagg tgggattact cgccaatacc aaggcaaatg
     451  agctggtgta ctcccgtcta tgccgagacg agatggttac ccacggtgtg
     501  cgcccatcgc acattgcaca cgcagtgccg cttgctgtcg cggcctgctt
     551  cataccgttg gacagtgatt tcctcgcagc ttctatcaga aactgcgaag
     601  agatggagga gcggagggcc gtactagggc cctcatatgg aaaataggga
     651  ggcctactct gcaccagcgg gtttaccacg cctacttggc gtggtaatcc
     701  agagggtttg ctggtgaaga gaggaccacc tctggctaaa cctaggaaac
     751  tgtaccgttt ttctgggttt gggactcata tacggtacgg agtgcacgat
     801  cactcattgg gcaatgttcg gaggggactt gttgagcggc tattcatggt
     851  tgaaaccaag gatggcttag ctccaacacc acagcccacc cctggcgtgt
     901  acgccaagtt atcccggttt catgaccttg ttagtgccaa cctaacctcg
     951  accaccagat taacatacga gcaattcctc ggattttatt ctggtcgcaa
    1001  attagagagg taccaacagg ccgtggagtc gttagcaatc cgcccaatag
    1051  gggtacagga tgcttggctt agcacgtttg ttaaggctga aaaattaaac
    1101  atctcagcta aacccgaccc ggcacctagg gttattcagc ctaggtcacc
    1151  gaggtacaat gtggaggttg gacggttcct cagacacgct gaggaacatc
    1201  tgttcgacgc tatcaaccgt gtgtatggtg ggcggacggt attcaagggg
    1251  ttgaatgccg atcaggctgg catggagatg caagccatgt ggcaagaatt
    1301  cgacaatcct gttggtattg gtatggatgc ctctcgtttc gaccaacacg
    1351  tctctaagga ggcgttggag tttgaacaca agatctggct atccatgtac
    1401  catggggctg acaggaaaac attatcgaag ctgttgggga tgcaaatcca
    1451  caaccgcggt cttgccagat gccctgatgg ggaaatcagg tacacagttg
    1501  aggggtgtcg tatgtctggg gatatcaaca catcttccgg aaactgctat
    1551  atcatgtgtg cttcggtgca caattattgc agccggttgg gtgttaaaag
    1601  attcaggctt gccaacaatg gtgatgattg catgcttgtt gtcgaagcca
    1651  aggatgaagc acgtgtcagg cagggactca tcgagtatta tagggaattg
    1701  ggtttcacca tgaaagtgga acctactgtc tatgaactcg agcacttgga
    1751  gttttgccag acacgtccag tccttgtcga tggggcatat cgaatggtgc
    1801  gcaatcttca ccagggcatg tctaaggatc ttcactcctt gcacgatctt
    1851  ggtagtagga aagctgctga agcttgggtt tcagcggttg gtagtggagg
    1901  ccgtgtgatg aatgatggag taccagtgct caaatcattc ttcatgcagt
    1951  ttcctctatc ctctggacct aaaaccaagt ccgacatgag tgtagcgttg
    2001  caggaagatt ggaaatacaa attcaatcgg actgggtgtt tcaagaactt
    2051  gacacccact ccacaatccc gctactcatt ttggcgtgca tttggagtgc
    2101  taccagatga acagattgcc ctggagaatg ggttttctcg tctcagcttt
    2151  gacaagctgg accaggatac ccaggaggag gttagcctcc tccagttctc
    2201  tggggcatga aaacctaacc acttttcatg gaacaacagc gtagtgaaca
    2251  acgtcgtgag cgtagagtga gaagtagatc ggaggacagg aagtctatgt
    2301  ctgatgtagg gcaatctgct gtcaataggg aagcagatgt caagaaagat
    2351  atgggtccat cggtttctat gacggtggtg ggggagaacg tagagtttac
    2401  acaacatttc cacttctgaa atgagcatca tttatgtcgt acaggagaag
    2451  ccctctgggt ttctcgtgtg ggcattggtt gttgcaattg tgtgcattat
    2501  tggactctta tcgtacactc cacctgaaag acttaaccac tcttatcacg
    2551  aaaacaatca gaagacgcaa tacataacta ttggaggaac atccactagt
    2601  aaagtttcca cgaactgaat tttctgcttt ctagtatagt caataaatgg
    2651  cacctaagcg caataaagga ggcaagaagt cccgcatgtc cgatgagaca
    2701  gtgcgggctc ctactgcagg gggcgttata caacgcacac ctggcattcc
    2751  tccccgcatt aggtccacca ctattggtac gcgtgtcact aacactgagt
    2801  tgctcgccgg agtgaatgtc gctgcggcgg gagctttctc agttgttggt
    2851  gctggtcttt tccccagcaa ccttggttgg ctcaatggga ttgcttccaa
    2901  ttatagcaaa tttaggtggc ttgctatcaa gctcatctac atccccattg
    2951  ttcctaccac gaccgctggg gcaatgacca tggctttatc gtatgatcct
    3001  gctgatgcta caccaactag tttccaacag gtacaacaga tgtataatag
    3051  catcacagca cctgtctggg ctggatttga tggagctact gttcagctgc
    3101  taggggagag accaacaact ggggctgtgt gcattgatgt agatgtgaat
    3151  cggtttggat tcacatggta tagatatgct acgcttgctg ccattaccgc
    3201  actcactgca aatgatagga atctctatat tcctagtgtc tgcaatgtgg
    3251  ctacgtctgg tggcactgca gccaccaatg ttggcaatct gatgataaag
    3301  tacagcattg agctcatcga gccaatacct gctgccatta attagatccc
    3351  acatcctggt gtggctaatc cagtgaaaaa tattaggaaa tccttgggat
    3401  tcacacccca gggaggattg cttgcatagt gcaggtatgt cgagtcacac
    3451  tatgaggtat tggtgctgaa tcctgggaaa caggcttgac aggtttgggt
    3501  ggttccagac cgatgtatta cccaagatac tcatggtact ctactagaaa
    3551  acactatgcg tgcgcacacg gctggctatg tcctatcata gctgggggcc
    3601  ccggagtgcg aaaccctctt atatacctgg tcttccaggt gccc