Sequence of DPV Cucumber mosaic virus satellite RNA

Cucumber mosaic virus satellite RNA isolate Sb-WI, complete sequence.

ACC No: KC415034

Dated: 2013-02-27 | Length: 338 | CRC: -1724260306

                
ID   KC415034; SV 1; linear; genomic RNA; STD; VRL; 338 BP.
XX
AC   KC415034;
XX
DT   27-FEB-2013 (Rel. 115, Created)
DT   27-FEB-2013 (Rel. 115, Last updated, Version 1)
XX
DE   Cucumber mosaic virus satellite RNA isolate Sb-WI, complete sequence.
XX
KW   .
XX
OS   Cucumber mosaic virus satellite RNA
OC   Viruses; Satellites; Satellite Nucleic Acids;
OC   Single stranded RNA satellites;
OC   Small linear single stranded RNA satellites.
XX
RN   [1]
RP   1-338
RA   Nouri S., Groves R.L.;
RT   "Influence of two newly characterized satellite RNAs of Cucumber mosaic
RT   virus on symptom development in Phaseolus vulgaris";
RL   Unpublished.
XX
RN   [2]
RP   1-338
RA   Nouri S., Groves R.L.;
RT   ;
RL   Submitted (24-DEC-2012) to the INSDC.
RL   Plant Pathology, University of Wisconsin-Madison, 1630 Linden Dr., Madison,
RL   WI 53706, USA
XX
FH   Key             Location/Qualifiers
FH
FT   source          1. .338
FT                   /organism="Cucumber mosaic virus satellite RNA"
FT                   /host="Phaseolus vulgaris"
FT                   /isolate="Sb-WI"
FT                   /mol_type="genomic RNA"
FT                   /country="USA"
FT                   /collection_date="2011"
FT                   /PCR_primers="fwd_name: satrnaf, fwd_seq:
FT                   gggaattcatttaggtgacactatagttttgtttg, rev_name: satrnar,
FT                   rev_seq: ggggtctagacccgggtcctg"
FT                   /db_xref="taxon:12436"
XX
SQ   Sequence 338 BP; 68 A; 85 C; 97 G; 88 T; 0 other;

kc415034 Length: 338  27-FEB-2013  Type: N  Check: 8040  ..

       1  gttttgtttg atggagaatt gcgtggaggg gttgtttctg cgtgaggatc
      51  catcactcgg cggtgtggga tacctccctg ctacggcggg ttgagtgacg
     101  tatctcggac tggggaccgc tggcctgagg gctatgtccg ctactctcag
     151  cactgcgctc tcatttgagc ccccgctcag tttgctagca aaacccggcc
     201  catggtttgc cgttaccgtg gaaatttcga aagaaacact ctgttaggtg
     251  gtatcgtgga cgacgcacac agggagaagc taaaacctat atggtcatgc
     301  tgatctccgc gtatgtacat cataccttta caggaccc