Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate T524 coat protein (CP) gene, complete cds.

ACC No: KC841797

Dated: 2013-05-29 | Length: 672 | CRC: -978850067

ID   KC841797; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841797;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate T524 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="T524"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:Ave 392 Road 168, Tulare County, California"
FT                   /isolation_source="originally from Lemon in Hatakeda grove
FT                   (Citrograph Aug. 1975, pg. 368)"
FT                   /collected_by="Dave Cordas"
FT                   /collection_date="1981"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="T524 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39394.1"
FT                   R"
SQ   Sequence 672 BP; 194 A; 118 C; 175 G; 185 T; 0 other;

kc841797 Length: 672  29-MAY-2013  Type: N  Check: 5415  ..

       1  atggacgacg agacaaagaa attgaagaac aaaaacaagg aaaagaaaga
      51  aggcgacaat gttgttgcag cagagtcttc tttcggttct gtaaacttac
     101  acatcgatcc gactctgata gcaatgaacg atgtgcgtca gttgggtacc
     151  caacagaatg ctgctttgaa cagagatttg tttcttacct tgaaagggaa
     201  gtatcctaat ttgtctgaca aagacaagga ctttcactta gctatgatgt
     251  tgtatcgttt agcagttaag agttcatcat tgcaaagtga tgatgacacc
     301  acgggtgtga cgtacactcg ggagggtgtt gaagtggaat tgtctgacaa
     351  actttggaca gacgtcgtgt ttaattctaa gggtattggt aaccgtgcta
     401  acgcccttcg agtctggggt agaactaacg atgcccttta tttagctttt
     451  tgtagacaga atcgcaattt gagttatggt ggacgtccgt tagatgcagg
     501  gattccagcc gggtatcact acctgtgtgc tgatttcttg accggagctg
     551  gcttgactga tttagaatgt gcagtgtaca tacaagctaa agagcaattg
     601  ttaaagaagc gaggggctga cgaggtcgta gttaccaatg tcaggcagct
     651  tgggaaattt aacacacgtt ga