Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate SY555 coat protein (CP) gene, complete cds.

ACC No: KC841800

Dated: 2013-05-29 | Length: 672 | CRC: 534855695

ID   KC841800; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841800;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate SY555 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="SY555"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:Riverside, California"
FT                   /isolation_source="originally from Tahitian Pummelo in
FT                   Riverside Citrus Research Center and Agricultural
FT                   Experiment Station"
FT                   /collected_by="Chester Roistacher"
FT                   /collection_date="1971"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="SY555 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39397.1"
FT                   R"
SQ   Sequence 672 BP; 199 A; 123 C; 170 G; 180 T; 0 other;

kc841800 Length: 672  29-MAY-2013  Type: N  Check: 3116  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgcag ctgagtcttc tttcggttcc gtaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtca gttgggtacc
     151  caacagaatg ctgctttgaa tagagatttg tttcttacct tgaaagggaa
     201  gtatcctaac ttacctgaca aagataaaga ctttcactta gctatgatgt
     251  tatatcgttt agcagttaag agttcatcat tacaaagcga cgatgacacc
     301  acgggtgtga cgtacactcg ggaaggtgtt gaagtggaat tgtctgacaa
     351  actttggaca gacatcgtgt ttaactctaa gggtattggt aaccgtacta
     401  acgcccttcg agtctggggt agaactaacg atgcccttta tttggctttt
     451  tgtagacaga atcgcaactt gagttatggt ggacgtccgt tagatgcagg
     501  aattccagcc gggtatcact acctgtgtgc agatttcttg accggagctg
     551  gattgactga tttagaatgt gcagtgtaca tacaagctaa agagcaattg
     601  ttgaagaagc gaggggctga tgaggtcgta gttaccaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga