Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate SY557 coat protein (CP) gene, complete cds.

ACC No: KC841802

Dated: 2013-05-29 | Length: 672 | CRC: 500159569

ID   KC841802; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841802;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate SY557 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="SY557"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:East Hawaii Branch Station, Waiakea, Hawaii"
FT                   /isolation_source="originally from Navel Orange on
FT                   Trifoliate rootstock in Warner Ranch"
FT                   /collected_by="Edmond C. Calavan"
FT                   /collection_date="1971"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="SY557 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39399.1"
FT                   R"
SQ   Sequence 672 BP; 188 A; 121 C; 178 G; 185 T; 0 other;

kc841802 Length: 672  29-MAY-2013  Type: N  Check: 5920  ..

       1  atggacgacg agacaaagaa attgaagaac aaaaacaagg aagcgaaaga
      51  tggcgacgat gttgttgcag cggagtcttc tttcggttct ataaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtca gttgggtacc
     151  caacagaatg ccgctttaaa cagagatttg tttcttactt tgaaagggaa
     201  gtatcctaat ttgtctgata aggataagga ctttcacata gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tacaaagtga tgacgacact
     301  acgggtataa cgtacactcg ggagggcgtc gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt ttaattctaa gggtatcggt aaccgtgcta
     401  acgcccttcg agtctggggt aggactaacg atgcccttta tttagccttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagagtgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctga tgaagtcgta gttaccaatg tcaggcagct
     651  tgggaaattt aacacacgtt ga