Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate SY565 coat protein (CP) gene, complete cds.

ACC No: KC841803

Dated: 2013-05-29 | Length: 672 | CRC: -101453477

ID   KC841803; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841803;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate SY565 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="SY565"
FT                   /mol_type="genomic RNA"
FT                   /country="Australia"
FT                   /isolation_source="originally from Parson's Special
FT                   Mandarin in Riverside Citrus Research Center and
FT                   Agricultural Experiment Station (CRC 300). CRC 300 was
FT                   received from Dr. Fawcett's Florida collection (#106) in
FT                   1914"
FT                   /collected_by="Chester Roistacher"
FT                   /collection_date="1978"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="SY565 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39400.1"
FT                   R"
SQ   Sequence 672 BP; 191 A; 120 C; 177 G; 184 T; 0 other;

kc841803 Length: 672  29-MAY-2013  Type: N  Check: 5389  ..

       1  atggacgacg agacaaagaa attgaagaac aaaaacaagg agacgaaaga
      51  aggcgacgat gttgttgcag cagagtcttc tttcggttcc gcgaatttac
     101  acatcgatcc gactctgata acgatgaacg atgtgcgtca gttgggaacc
     151  caacagaacg ctgctttgaa cagagatttg tttcttactc tgaaagggaa
     201  gtatcctagc ttgtctgaca aggataagga cttccacata gctatgatgt
     251  tatatcgttt agcggttaag agttcatcgt tgcaaagtga tgatgacacc
     301  acgggcataa catatactcg agagggtgtt gaagtggatt tgtctgacaa
     351  gctttggact gacgtcgtgt ttaactctaa gggtattggt aaccgtacta
     401  atgcccttcg agtctggggt aggactaacg atgcccttta tttagctttc
     451  tgtagacaga atcgcaattt gagttatggt ggacgtccgc tagatgcagg
     501  gattccggct gggtatcatt acctatgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gctgtgtaca tacaagctaa ggaacaattg
     601  ttaaagaagc gaggggctga tgaagtcgta gttactaatg tcaggcagct
     651  tgggaaattt aacacacgtt ga