Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate T510 coat protein (CP) gene, complete cds.

ACC No: KC841807

Dated: 2013-05-29 | Length: 672 | CRC: -1964357411

ID   KC841807; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841807;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate T510 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="T510"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:Bryn Mawr, San Bernardino County, California"
FT                   /isolation_source="originally from a declining Grapefruit
FT                   on Sour orange rootstock in Daniels Grove in Bryn Myr,
FT                   California"
FT                   /collected_by="Dick Puffer and Edmond C. Calavan"
FT                   /collection_date="1972"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="510 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: T30+VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39404.1"
FT                   R"
SQ   Sequence 672 BP; 197 A; 122 C; 170 G; 183 T; 0 other;

kc841807 Length: 672  29-MAY-2013  Type: N  Check: 3219  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgctg ctgagtcttc tttcggttcc gtaaacttac
     101  acatcgatcc gactctgata acgatgaacg atgtgcgtca gttgagtact
     151  caacagaatg ctgctttgaa cagggactta tttcttgctc tgaaagggaa
     201  gtatcctaac ttgcctgaca aagataagga ctttcacata gctatgatgt
     251  tataccgttt agcggttaag agttcatcat tgcaaagtga tgatgacacc
     301  acgggcataa cgtacactcg ggagggtgtt gaagtagatt tgtctgacaa
     351  actttggacc gacatcgtgt ataattctaa gggtattggt aaccgaacta
     401  acgcccttcg agtctggggt agaactaacg atgctcttta cttagccttt
     451  tgtagacaga accgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggct gggtatcatt atttgtgtgc agatttcttg accggagctg
     551  gcttgaccga tttagaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaaaaagc gaggggctga tgaggttgta gttactaatg tcaggcagct
     651  tgggaaattt aacacacgtt ga