Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate SY568 coat protein (CP) gene, complete cds.

ACC No: KC841814

Dated: 2013-05-29 | Length: 672 | CRC: -757968013

ID   KC841814; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841814;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate SY568 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="SY568"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:Riverside, California"
FT                   /isolation_source="originally from a stunted and pitted
FT                   Minneola Tangelo tree in Riverside Citrus Research Center
FT                   and Agricultural Experiment Station (CRC 3340). The CRC
FT                   3340 was received as budwood from USDA station at Indio,
FT                   California in 1961. The introduction to Indio was from a
FT                   seedling tree from the USDA station at Weslaco, Texas in
FT                   1959"
FT                   /collected_by="Edmond C. Calavan and Chester Roistacher"
FT                   /collection_date="1978"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="SY568 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside The SY568 is the most severe reacting CTV
FT                   seedling yellows and stem pitting isolate in the CCPP
FT                   collection that has been extensively used in many
FT                   experiments and it was first reported by Calavan et al.
FT                   1980. Natural Spread of Seedling Yellows and Sweet Orange
FT                   and Grapefruit Stem Pitting Tristeza Viruses at the
FT                   University of California, Riverside. Proceedings of the 8th
FT                   IOCV, pg.: 69-75. acronym: CTV; genotype: T30+VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39411.1"
FT                   R"
SQ   Sequence 672 BP; 191 A; 124 C; 177 G; 180 T; 0 other;

kc841814 Length: 672  29-MAY-2013  Type: N  Check: 3265  ..

       1  atggacgacg agacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgcag cggagtcttc tttcggttcc ttaaacttac
     101  acatcgatcc gactctgata gcgatgaacg acgtgcgtca gttaggtacc
     151  caacagaatg ccgctttgaa cagagatttg ttccttactt tgaaagggaa
     201  gtatcctaat ttgtctgata aagataagga ctttcacata gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tgcaaagtga tgacgacacc
     301  acgggcataa cgtacactcg ggagggcgtc gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt tcaattctaa gggtatcggt aaccgtacta
     401  acgcccttcg agtctggggt agaagtaacg atgcccttta tttagcgttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttggaatgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctga tgaagtcgta gttactaatg tcaggcagct
     651  tgggaaattt aacacacgtt ga