Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate SY575 coat protein (CP) gene, complete cds.

ACC No: KC841815

Dated: 2013-05-29 | Length: 672 | CRC: 585805264

ID   KC841815; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841815;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate SY575 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="SY575"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:Marion street, Redlands, San Bernardino
FT                   County, California"
FT                   /isolation_source="originally from a declining tree in
FT                   Murray Grove"
FT                   /collected_by="Chester Roistacher"
FT                   /collection_date="1980"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="SY575 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: T30+VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39412.1"
FT                   R"
SQ   Sequence 672 BP; 189 A; 122 C; 177 G; 184 T; 0 other;

kc841815 Length: 672  29-MAY-2013  Type: N  Check: 5042  ..

       1  atggacgacg agacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacaat gttgttgcag cggagtcttc tttcggttct gtaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtcg gttgggtacc
     151  caacagaatg ccgctttgaa cagagatttg tttcttactt tgaaagagaa
     201  gtatcctaat ttgtctgata aagataagga ctttcactta gctatgatgt
     251  tgtatcgttt agcggttaag agttcatcat tgcaaagcga tgacgacact
     301  acgggtataa cgtacactcg ggagggcgtc gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt ttaattctaa gggtatcggt aaccgtacta
     401  acgcccttcg agtctggggt aggactaacg atgcccttta tttagccttt
     451  tgtagacaga atcgcaattt gagttatggc ggacgtccgc tagatgcagg
     501  gattccggcc gggtatcatt acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagagtgt gctgtgtaca tacaagctaa agaacaattg
     601  ttgaagaagc gaggggctga tgaagtcgta gttaccaatg tcaggcagct
     651  tgggaaattt aacacacgtt ga