Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate SY580 coat protein (CP) gene, complete cds.

ACC No: KC841818

Dated: 2013-05-29 | Length: 672 | CRC: 1294798432

ID   KC841818; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841818;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate SY580 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="SY580"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:Riverside, California"
FT                   /isolation_source="originally from Finike Sweet Orange in
FT                   Riverside Citrus Research Center and Agricultural
FT                   Experiment Station (CRC 3479). CRC 3479 was received by Ed
FT                   Nauer as budwood from Turkey in 1963. Trees were propagated
FT                   in the Rubidoux quarantine screenhouse and when fruited
FT                   seedlings were planted in the CRC fields in 1966"
FT                   /collected_by="Chester Roistacher"
FT                   /collection_date="1980"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="SY580 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: T30+VT"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39415.1"
FT                   R"
SQ   Sequence 672 BP; 198 A; 122 C; 170 G; 182 T; 0 other;

kc841818 Length: 672  29-MAY-2013  Type: N  Check: 4050  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacgaaaga
      51  aggcgacgat gttgttgcag ctgagtcttc tttcggttcg ttaaacttac
     101  acatcgatcc gactctgata gcgatgaacg atgtgcgtca gttgggtacc
     151  caacagaatg ctgctttgaa tagagatttg tttcttacct tgaaagggaa
     201  gtatcccaac ttacctgaca aagataaaga ctttcacata gctatgatgt
     251  tatatcgttt agcagttaag agttcatcat tacaaagcga cgatgatacc
     301  acgggtgtga cgtacactcg ggaaggtgtt gaagtggagt tgtctgacaa
     351  actttggaca gacgtcgtgt ttaactctaa gggtattggt aaccgtacta
     401  acgcccttcg agtctggggt agaactaacg atgcccttta tttggctttt
     451  tgtagacaga accgcaactt gagttatggt ggacgtccgt tagatgcagg
     501  aattccagcc gggtatcact acctgtgtgc agatttcttg accggagctg
     551  gcttgactga tttagaatgt gcagtgtact tacaagctaa agagcaatta
     601  ttaaagaagc gaggggctga tgaggtcgta gttactaatg tcaggcagct
     651  tgggaaattt aacacacgtt ga