Sequence of DPV Citrus tristeza virus

Citrus tristeza virus isolate SY553 coat protein (CP) gene, complete cds.

ACC No: KC841823

Dated: 2013-05-29 | Length: 672 | CRC: -942164301

ID   KC841823; SV 1; linear; genomic RNA; STD; VRL; 672 BP.
AC   KC841823;
DT   29-MAY-2013 (Rel. 116, Created)
DT   29-MAY-2013 (Rel. 116, Last updated, Version 1)
DE   Citrus tristeza virus isolate SY553 coat protein (CP) gene, complete cds.
KW   .
OS   Citrus tristeza virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Closteroviridae;
OC   Closterovirus.
RN   [1]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   "Past and future of a century old Citrus tristeza virus collection. A
RT   California citrus germplasm tale";
RL   Unpublished.
RN   [2]
RP   1-672
RA   Wang J., Bozan O., Kwon S.-J., Dang T., Rucker T.L., Yokomi R.K., Lee R.K.,
RA   Folimonova S.Y., Krueger R.R., Bash J.A., Greer G.D., Diaz J.M.,
RA   Serna R.S., Vidalakis G.;
RT   ;
RL   Submitted (28-MAR-2013) to the INSDC.
RL   Department of Plant Pathology and Microbiology, University of California,
RL   Riverside, 900 University Ave., Riverside, CA 92521, USA
CC   ##Assembly-Data-START##
CC   Assembly Method       :: DNA Dragon v. 1.5.3
CC   Assembly Name         :: CTV-CP
CC   Coverage              :: 3
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .672
FT                   /organism="Citrus tristeza virus"
FT                   /lab_host="Citrus sinensis"
FT                   /isolate="SY553"
FT                   /mol_type="genomic RNA"
FT                   /country="USA:Riverside, California"
FT                   /isolation_source="originally from Meyer Lemon in Riverside
FT                   Citrus Research Center and Agricultural Experiment Station
FT                   ( PI 23028 & CRC 662). CRC 662 was introduced as plants
FT                   from USDA Plant Introduction Station Chico, California in
FT                   1917. The PI 23028 was introduced from China by F Meyer"
FT                   /collected_by="Chester Roistacher"
FT                   /collection_date="1960"
FT                   /PCR_primers="fwd_name: CP-U-F-16054-16075, fwd_seq:
FT                   cwtgagcrctgctttaagggtc, rev_name: CP-U-R-16836-16814,
FT                   rev_seq: gatgaaactccaccatcccgata"
FT                   /note="SY553 is maintained in planta at the Citrus Clonal
FT                   Protection Program (CCPP), University of California,
FT                   Riverside; acronym: CTV; genotype: VT+T36"
FT                   /db_xref="taxon:12162"
FT   gene            1. .672
FT                   /gene="CP"
FT   CDS             1. .672
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /note="major coat protein"
FT                   /protein_id="AGM39420.1"
FT                   R"
SQ   Sequence 672 BP; 198 A; 127 C; 166 G; 181 T; 0 other;

kc841823 Length: 672  29-MAY-2013  Type: N  Check: 1063  ..

       1  atggacgacg aaacaaagaa attgaagaac aaaaacaagg aaacaaaaga
      51  aggcgacgat gttgttgctg ccgagtcttc tttcagttcc gtaaacttac
     101  acatcgatcc gactttgata acgatgaacg atgtgcgtca gttgagtacc
     151  caacagaacg ctgctttgaa cagagactta ttcctcactt tgaaagggaa
     201  gcatcctaac ttacccgata aagataaaga ctttcacata gctatgatgt
     251  tgtatcgttt agcagttaag agttcatcat tacaaagcga tgacgacgcc
     301  acgggtataa cgtacactcg ggagggtgtt gaagtggatt tgtctgacaa
     351  actttggact gacgtcgtgt ttaactctaa gggtattggt aaccgtacta
     401  acgcccttcg agtttggggt agaactaacg atgcccttta cttagctttt
     451  tgcagacaga atcgcaattt gagttatggc ggacgtccgc tagacgcagg
     501  gattccggcc gggtatcatt acttgtgtgc ggatttcttg actggagctg
     551  gtttgactga tttagaatgt gctgtgtaca tacaagctaa agaacaatta
     601  ttgaagaagc gaggggctga tgatgtcgta gttactaatg tcaggcagct
     651  tgggaaattc aacacacgtt ga