Sequence of DPV Maize chlorotic mottle virus

Maize chlorotic mottle virus cp gene for coat protein, genomic RNA, isolate MC3/1-15

ACC No: AM490792

Dated: 2007-02-19 | Length: 711 | CRC: -2036363777

ID   AM490792; SV 1; linear; genomic RNA; STD; VRL; 711 BP.
AC   AM490792;
DT   19-FEB-2007 (Rel. 90, Created)
DT   19-FEB-2007 (Rel. 90, Last updated, Version 1)
DE   Maize chlorotic mottle virus cp gene for coat protein, genomic RNA, isolate
DE   MC3/1-15
KW   coat protein; cp gene.
OS   Maize chlorotic mottle virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Tombusviridae;
OC   Machlomovirus.
RN   [1]
RP   1-711
RA   Wongsuwan P.;
RT   ;
RL   Submitted (30-JAN-2007) to the EMBL/GenBank/DDBJ databases.
RL   Wongsuwan P., Agricultural Biotechnology, Kasetsart University, Malaiman
RL   Rd, Kamphaeng Sean, Nakhon Pathom, 73140, THAILAND.
RN   [2]
RA   Wongsuwan P., Chiemsombat P., Kruakhuanpet J.;
RT   "Occurrence of Maize chlorotic mottle machomovirus in sweet corn";
RL   Unpublished.
FH   Key             Location/Qualifiers
FT   source          1. .711
FT                   /organism="Maize chlorotic mottle virus"
FT                   /isolate="MC3/1-15"
FT                   /mol_type="genomic RNA"
FT                   /country="Thailand:Petchaboon province"
FT                   /identified_by="Pikulkaew Wongsuwan"
FT                   /virion
FT                   /PCR_primers="fwd_name: F-MCMV, fwd_seq:
FT                   caatggcggcaagtagccg, rev_name: R-MCMV, rev_seq:
FT                   gctcaatgatttgccagccc"
FT                   /db_xref="taxon:12138"
FT   CDS             1. .711
FT                   /gene="cp"
FT                   /product="coat protein"
FT                   /protein_id="CAM32983.1"
FT                   LQPALVPGPGLANH"
SQ   Sequence 711 BP; 179 A; 209 C; 178 G; 145 T; 0 other;

am490792 Length: 711  19-FEB-2007  Type: N  Check: 8874  ..

       1  atggcggcaa gtagccggtc tacccgaggt agaaagcagc gcggacgtag
      51  cgtggaagca aaatccagag ctattcgagc caacccgcct gtccttcgac
     101  ccaacccgca gcgaaaccgt cccccacctg cgggaacaac ctgctccatg
     151  tccgaaattc tgcttgcagt gtcagcaaca actgctgacc aaattctcga
     201  gattccagtg tgcgcaggga ttgacttccc agctggaacg ccaccccgat
     251  acattggggc ggccaaatgg ctggcagcac aatcacagat gtggaacaca
     301  attgtgttca actctgtgcg catcacttgg gaaacattca cagcagacac
     351  cactagcgga tacatctcca tggcattcct ctctgattac atgctatcaa
     401  tacccactgg ggtggaggat gttgccagga tcgtgccctc agctacaata
     451  gctctgaaga acagggggcc gtccattgtt atgccacaaa accgcactgt
     501  gttcaggtgc atacaggctg gtcagtttgc tgcgttgggc agcgcggctg
     551  acaagcaaat gtattccccc ggacgattca ttgtggctat ccccaaagct
     601  agtgcaacac aagcggtagg ccaaatcaaa atctcgtact ccgtgtccta
     651  ccgtggagca gcaatcctac aacctgccct ggttccaggc ccagggctgg
     701  caaatcattg a