Sequence of DPV Maize chlorotic mottle virus

Maize chlorotic mottle virus isolate Yunnan, complete genome.

ACC No: GU138674

Dated: 2011-03-20 | Length: 4436 | CRC: -1611160070

ID   GU138674; SV 1; linear; genomic RNA; STD; VRL; 4436 BP.
AC   GU138674;
DT   20-NOV-2009 (Rel. 102, Created)
DT   20-MAR-2011 (Rel. 108, Last updated, Version 2)
DE   Maize chlorotic mottle virus isolate Yunnan, complete genome.
KW   .
OS   Maize chlorotic mottle virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Tombusviridae;
OC   Machlomovirus.
RN   [1]
RP   1-4436
RA   Xie L., Zhang J., Wang Q., Meng C., Hong J., Zhou X.;
RT   "Characterization of Maize Chlorotic Mottle Virus Associated with Maize
RT   Lethal Necrosis Disease in China";
RL   J. Phytopathol. 159(3):191-193(2011).
RN   [2]
RP   1-4436
RA   Xie L., Zhang J., Hong J., Meng C., Zhang Z., Zhou X.;
RT   ;
RL   Submitted (28-OCT-2009) to the EMBL/GenBank/DDBJ databases.
RL   Zhejiang University, Bio-technology, Kaixuan Road 268#, Hangzhou, Zhejiang
RL   310029, China
FH   Key             Location/Qualifiers
FT   source          1. .4436
FT                   /organism="Maize chlorotic mottle virus"
FT                   /host="Zea mays"
FT                   /isolate="Yunnan"
FT                   /mol_type="genomic RNA"
FT                   /country="China"
FT                   /collection_date="Apr-2009"
FT                   /PCR_primers="fwd_seq: cgttagacacgaccttacagttg, rev_seq:
FT                   ccacggtaggacacggagtacg"
FT                   /PCR_primers="fwd_seq: ggaggtccaagagagcgctcgct, rev_seq:
FT                   ctgggagatttgtgattgttccc"
FT                   /PCR_primers="fwd_seq: gtgtttatgccgtgtcgtactgat, rev_seq:
FT                   gtgatacgcacagagttgaaca"
FT                   /PCR_primers="fwd_seq: tgttgagcacccaatctaccatgc, rev_seq:
FT                   tctgaggcgtatgctgttccacg"
FT                   /PCR_primers="fwd_seq: ttctgtgcgtatcacttgggaa, rev_seq:
FT                   tgagtaacgagcgctctcttggacc"
FT                   /db_xref="taxon:12138"
FT   CDS             118. .987
FT                   /codon_start=1
FT                   /product="32 kDa protein"
FT                   /db_xref="UniProtKB/TrEMBL:D1MF36"
FT                   /protein_id="ACY82507.1"
FT                   SLPSGLSD"
FT   CDS             137. .3034
FT                   /codon_start=1
FT                   /transl_except=(pos:1451. .1453,aa:OTHER)
FT                   /product="111 kDa protein"
FT                   /note="putative replicase; read through product of amber
FT                   stop codon"
FT                   /db_xref="GOA:D1MF37"
FT                   /db_xref="InterPro:IPR002166"
FT                   /db_xref="InterPro:IPR007094"
FT                   /db_xref="UniProtKB/TrEMBL:D1MF37"
FT                   /protein_id="ACY82508.1"
FT   CDS             137. .1453
FT                   /codon_start=1
FT                   /product="50 kDa protein"
FT                   /note="putative replicase"
FT                   /db_xref="UniProtKB/TrEMBL:D1MF38"
FT                   /protein_id="ACY82509.1"
FT   CDS             2995. .3834
FT                   /codon_start=1
FT                   /transl_except=(pos:3199. .3201,aa:OTHER)
FT                   /product="p31 protein"
FT                   /note="contains read through stop codon"
FT                   /db_xref="UniProtKB/TrEMBL:D1MF39"
FT                   /protein_id="ACY82510.1"
FT   CDS             2995. .3201
FT                   /codon_start=1
FT                   /product="p7 protein"
FT                   /db_xref="UniProtKB/TrEMBL:D1MF40"
FT                   /protein_id="ACY82511.1"
FT   gene            3384. .4094
FT                   /gene="CP"
FT                   /note="MCMV-CP"
FT   CDS             3384. .4094
FT                   /codon_start=1
FT                   /gene="CP"
FT                   /product="coat protein"
FT                   /db_xref="GOA:A2VB95"
FT                   /db_xref="InterPro:IPR000937"
FT                   /db_xref="UniProtKB/TrEMBL:A2VB95"
FT                   /protein_id="ACY82512.1"
FT                   LQPALVPGPGLANH"
SQ   Sequence 4436 BP; 1191 A; 1116 C; 1121 G; 1008 T; 0 other;

gu138674 Length: 4436  20-MAR-2011  Type: N  Check: 5117  ..

       1  aggtaatctg cggcaacaga ccccaacgcg ttagacacga ccttacagtt
      51  gactcacgtc ttgcatcctg tgagagcttt agcgtgggaa tttgcccctg
     101  actggcaatc aggtttcatg ccctctccgt gcacatatgg cgaccctacc
     151  ttcaattcac gcattttgga agctgtggtg gccgacgttc tcggaggaac
     201  ggaagatgac ggtggtccaa gccttgagga atggtttgac gcgcaaactc
     251  tttcagatta cacgaattgc gcaacagatc ctccgatggc caccgtacat
     301  acgcgagaga gtgacatcaa gtcttggacg gagcttagtg aaaactttcc
     351  agaccttgtt aggtatccgg aaagtcttgt cgaaactctg cttgacacgg
     401  aacatgaatg tggacatttt tacgatgctc ctgattcctt tcagatttct
     451  gtcacagcta tgttcacaga tcgttgcaag tgccaggcat gtgatccaga
     501  ctttcaagca cggtctctct cgcgggctct gcttggcccg ttgccggaat
     551  ccggagacga tgcggagtgg atggagcaag catacactcc agatgcagaa
     601  ttgttcgtca acgagcccac tgatgacccc attccaacca cagactgcaa
     651  gagacctatc caacccacat ggtctgtgga tgtctactcg aaacaagttg
     701  actcagactg gggactcagt gattcaacaa acgtcacggt acgttcggct
     751  agcagttcgc ttctccctgc tggccgcggg ggcatatttt tcatgtgtcc
     801  tcgcccggaa ggcattgaaa gagtatgtct acaggtggga gctaaaatcc
     851  gatcaggaac tcccaactcg ggaacaatca caaatctccc aggtggaaca
     901  ggctatggaa cagaatggag cgatgatggt tatgaaactc aatggtccga
     951  cggcccctat tctctccctt caggactgtc tgactaaaca cgttctggtt
    1001  ccagagattg tggacgaaga aggcacagtg acacagaaag agcagtccac
    1051  atttctcatc cgtgagtttg gccctgccgt cagaaaccta gtgaccctcg
    1101  caaaactaga attcggcggg attccaaaga aaaccactgc caacgaactc
    1151  acggtttggc ggttcctggt acggaagtgt gagcaagcaa atatgaatcc
    1201  aactgactcc cgtactgcca tttcaatggc cctgccatat gtgtttatgc
    1251  cgtgtcgtac tgatgttgga agagcttcaa ttccactgcg tgatgaatcc
    1301  attgagatct gtcgccaata tcgcgcacaa tttgtggagg agacacccct
    1351  acggcgagta ttcaacaacc cactgagcgg aaaagcatgg cgtaattggg
    1401  ttaggcacct gggtgggctg gatgatccag ccctattcca ggagctgaaa
    1451  taggggtgtc ttgaagagtg gcttggggtg cagtctcggc gcacacgtgc
    1501  gcggcatccc aaactccgta gccactttaa agacacgaga cacaaaaccc
    1551  gcagagtgtt ccggattgca ggtttgggca acctgtatga atttggggtc
    1601  cacaacaact ctgcggttaa cctggaacgt ggactgatgg aacgagtatt
    1651  ttatgtgaaa aatgataagg gggaactcgt ttcatgccct gagccaatta
    1701  gtgggatatt ttggaaaaat ttgaagggat tcagaaatag cattgttcac
    1751  catgtgggac acagacatcc ggtgtcacga gagacgtttc tcgcttacta
    1801  tacagggcca aagcgcacca tgtatgagaa agcggtgaat tccctctacg
    1851  aaatgcctgt ctcatacgac gatgctaaac tgaaaacatt tgtcaaagca
    1901  gaaaagatca atctcactaa gaaagctgat cctgtaccac gtgtgatcca
    1951  accccgtgct ccccggtaca atgtggaact gggtaggtat ttgagaccgg
    2001  ttgagcaccc aatctaccat gccatagaca agatttgggg tggtccgact
    2051  atcatgaaag gttactcggt tgaacagatt ggaagacaca tcgaaaacgc
    2101  gtttcgatcg ttcaccgatc cagtagccat tggatttgat gcaagtcggt
    2151  ttgatcaaca cgtgagtgtt gaagctctac gctgggaaca tagcgtatac
    2201  acaaggattt atggctatcc agagcttctc acacaattgc tgcggtggca
    2251  gattcacaat cgtggaacag catacgcctc agacggcgcg ttcaactacc
    2301  aggtggatgg taaacgcatg agtggagaca tgaacacatc attgggcaat
    2351  tgcatcctgg ccacagcaat cacacatgac ttcgtgacca agctgggaat
    2401  tccagccaga ttaatcaaca atggagatga caacgtcatg atctgtccgg
    2451  cagtggaggt aggcagagtc agacaggaac tgtacagaca ttggttgaac
    2501  tacggatttg aagtcatatc agaagaacct gtatacatcc ttgaacaggt
    2551  tgagttttgc ctgatgcgac cagtctttga cggtacacaa tacaccatga
    2601  tgagagaccc acgcaccacc atgtccaagg atgcatatgc tgttacccct
    2651  tttaacacgc caaccgcagc aaggaggtgg atgagagcag ttggggaatg
    2701  cggactcagc cttacaggag gcctccccgt aaagcaggaa tactatgctg
    2751  ctctcgtgaa acacggacta gatccgaaaa acattaaaca gggaaaagac
    2801  tttgacagtg ggctatatta tcttagcaag ctatccaatc gcaaatggca
    2851  ggaggtccaa gagagcgctc gttactcatt ctggcttgct ttcgggtaca
    2901  caccagatga acaacgagcg ttagaggagt attttagatc ttggactcct
    2951  acgtttgaat ggtccacaac gggtattttg gcagaaatcc ccgaatgtct
    3001  tcttctcaaa cacaatcccc tcccaccgac gtagcccgca gacaacagac
    3051  cggcactgcc gtgcgatccg aagacaacca tcgcaatcag ttggaaaaca
    3101  ttgctgttgg aaaactcacc aaatctgaag gagcacccgc ccaacagaac
    3151  gtgatcattg cgaaagaggt ggttatcaat aaccacttca atttcaactg
    3201  agctggagtg tgtgtgtgta gattcgtcct ggcctcagtg gttaaggaat
    3251  ttaatcttgg ggattatgat ctcctcgatt ctgttcatct tgacgaagac
    3301  agaggacacc gttgccgttt atcacgagcc atcggtgtac tcgatcgatc
    3351  agtcacaaaa attccaaaag atcgacatac acaatggcgg caagtagccg
    3401  gtctacccga ggtagaaagc agcgcggacg tagcgtggaa gcaaaatcca
    3451  gagctattcg agccaacccg cctgtccttc gacccaaccc gcagcgaaac
    3501  cgtcccccac ctgcgggaac aacctgctcc atgtccgaaa ttctgcttgc
    3551  agtgtcagca acaactgctg accaaattct cgagattcca gtgtgcgcag
    3601  ggattgactt cccagctgga acgccacccc gatacattgg ggcggccaaa
    3651  tggctggcag cacaatcaca gatgtggaac acaattgtgt tcaactctgt
    3701  gcgtatcact tgggaaacat tcacagcaga caccactagc ggatacattt
    3751  ccatggcatt cctctctgat tacatgctat caatacccac tggggtggag
    3801  gatgttgcca ggatcgtgcc ctcagctaca atagctctga agaacagagg
    3851  gccgtccatt gttatgccac aaaaccgcac tgtgttcagg tgcatacagg
    3901  ctggtcagtt tgctgcgttg ggcagcgcgg ctgacaagca aatgtattcc
    3951  cccggacgat tcattgtggc tatccccaaa gctagtgcaa cacaagcggt
    4001  aggccaaatc aaaatctcgt actccgtgtc ctaccgtgga gcagcaatcc
    4051  tacaacctgc cctggttcca ggcccagggc tggcaaatca ttgaacacaa
    4101  ggtgagccgg catgaggttg caagaccgga ataaccagtc gttctggcag
    4151  agtcctgcca atccaaagtg tttgggagcc taaatcgtat actagtagtt
    4201  tgcgtgatga ccatgactgg agagtgggcg gcggctgcca accgcagact
    4251  gggcgtatat agtaagcctt gacccaccca tggacaacac gtacttacga
    4301  acggtgcgac atggtaactg gatacactta accctggggc atgtagatgc
    4351  taggaaacta gcatcgggcc gcccacgagg gtttctgaac tctacggagt
    4401  agatcggggg ggggtaatgc ccctctcttc cggccc