Sequence of DPV Turnip crinkle virus

Turnip crinkle virus strain M 38 kDa protein gene, partial cds.

ACC No: HQ589261

Dated: 2011-01-13 | Length: 1053 | CRC: -1950745840

ID   HQ589261; SV 1; linear; genomic RNA; STD; VRL; 1053 BP.
AC   HQ589261;
DT   13-JAN-2011 (Rel. 107, Created)
DT   13-JAN-2011 (Rel. 107, Last updated, Version 1)
DE   Turnip crinkle virus strain M 38 kDa protein gene, partial cds.
KW   .
OS   Turnip crinkle virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Tombusviridae;
OC   Carmovirus.
RN   [1]
RP   1-1053
RA   Bakker S.E., Pearson A.R., Stockley P.G., Ranson N.A.;
RT   "Structural and Functional Studies of the Turnip Crinkle Virus Virion
RT   Reveals the Mechanism of Genome Uncoating";
RL   Unpublished.
RN   [2]
RP   1-1053
RA   Bakker S.E., Pearson A.R., Stockley P.G., Ranson N.A.;
RT   ;
RL   Submitted (08-NOV-2010) to the EMBL/GenBank/DDBJ databases.
RL   Astbury Centre for Structural Molecular Biology, University of Leeds,
RL   Clarendon Road, Leeds, W. Yorkshire LS2 9JT, UK
FH   Key             Location/Qualifiers
FT   source          1. .1053
FT                   /organism="Turnip crinkle virus"
FT                   /strain="M"
FT                   /mol_type="genomic RNA"
FT                   /PCR_primers="fwd_name: Forward I, fwd_seq:
FT                   cctgaaatcaaaccgattcacacatcc, rev_name: Reverse II, rev_seq:
FT                   ccctaacacaggtcaaaataaagcg"
FT                   /db_xref="taxon:11988"
FT   CDS             1. .>1053
FT                   /codon_start=1
FT                   /product="38 kDa protein"
FT                   /note="coat protein"
FT                   /protein_id="ADT78694.1"
FT                   QPKGKWQALRI"
SQ   Sequence 1053 BP; 276 A; 287 C; 292 G; 198 T; 0 other;

hq589261 Length: 1053  13-JAN-2011  Type: N  Check: 7457  ..

       1  atggaaaatg atcctagagt ccggaagttc gcatctgatg gcgcccaatg
      51  ggcgataaag tggcagaaga agggctggtc aaccctaacc agcagacaga
     101  aacagaccgc ccgcgcagcg atggggatca agctctctcc tgtggcgcaa
     151  cctgtgcaga aagtgactcg actgagtgct ccggtggccc ttgcctaccg
     201  cgaggttacc acccagcctc gggtctctac tgccagggac ggcataacca
     251  gaagcggttc tgaactgatc acaaccttga agaagaacac tgacactgaa
     301  cctaagtaca ccacagctgt gcttaaccca agcgaacccg gaacattcaa
     351  ccagctcatt aaggaggcgg cccagtatga aaaataccga ttcacgtcac
     401  tcagatttag gtactccccc atgagccctt caaccaccgg aggcaaggtg
     451  gctctggcat tcgatcgaga tgccgccaaa cctccgccca acgacctcgc
     501  ttccctctac aacatagagg gttgtgtatc tagcgtgccc tggacagggt
     551  ttattttgac cgtcccaaca gattctactg accgctttgt ggcggatggt
     601  atcagcgatc caaagcttgt cgatttcggc aagctcatca tggccaccta
     651  cggccaagga gccaatgatg ccgcccaact cggtgaagtg cgagtcgagt
     701  acaccgtgca gctcaagaac agaactggct caaccagcga cgcccagatt
     751  ggggacttcg caggtgttaa ggacggaccc aggctggttt catggtccaa
     801  gaccaagggg acagctgggt gggagcacga ttgtcatttt ctcggaaccg
     851  gaaacttctc gttgacattg ttctacgaga aggcgccggt ctcggggcta
     901  gaaaacgcag acgcctctga cttctcggtc ctgggagaag ccgcagcagg
     951  tagtgtccaa tgggcaggag tgaaggtagc agaaagggga caaggcgtga
    1001  aaatggtcac aactgaggag cagccaaagg gtaaatggca agcactcaga
    1051  att