Sequence of DPV Maize chlorotic mottle virus

Maize chlorotic mottle virus isolate YN10 coat protein gene, complete cds.

ACC No: JQ943674

Dated: 2012-06-18 | Length: 711 | CRC: 436279776

ID   JQ943674; SV 1; linear; genomic RNA; STD; VRL; 711 BP.
AC   JQ943674;
DT   18-JUN-2012 (Rel. 113, Created)
DT   18-JUN-2012 (Rel. 113, Last updated, Version 1)
DE   Maize chlorotic mottle virus isolate YN10 coat protein gene, complete cds.
KW   .
OS   Maize chlorotic mottle virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Tombusviridae;
OC   Machlomovirus.
RN   [1]
RP   1-711
RA   Wang Q., Wu J., Hong J., Zhou X.;
RT   "Phylogenetic analysis of Maize chlorotic mottle virus in China";
RL   Unpublished.
RN   [2]
RP   1-711
RA   Wang Q., Wu J., Hong J., Zhou X.;
RT   ;
RL   Submitted (18-APR-2012) to the INSDC.
RL   College of Agriculture and Biotechnolog, Zhejiang University, Institute of
RL   Biotechnology, 388, Yu Hang Tang Road, HangZhou, Zhejiang 310058, China
CC   ##Assembly-Data-START##
CC   Sequencing Technology :: Sanger dideoxy sequencing
CC   ##Assembly-Data-END##
FH   Key             Location/Qualifiers
FT   source          1. .711
FT                   /organism="Maize chlorotic mottle virus"
FT                   /host="Zea mays"
FT                   /isolate="YN10"
FT                   /mol_type="genomic RNA"
FT                   /country="China:Yuanjiang, Yunnan"
FT                   /collection_date="Feb-2012"
FT                   /PCR_primers="fwd_name: 3301-F, fwd_seq:
FT                   acaggacaccgttgccgtttat, rev_name: 4187-R, rev_seq:
FT                   cgatttaggctcccagacactt"
FT                   /db_xref="taxon:12138"
FT   CDS             1. .711
FT                   /codon_start=1
FT                   /product="coat protein"
FT                   /note="CP"
FT                   /protein_id="AFM31237.1"
FT                   LQPALVPGPGLANH"
SQ   Sequence 711 BP; 180 A; 211 C; 177 G; 143 T; 0 other;

jq943674 Length: 711  18-JUN-2012  Type: N  Check: 7919  ..

       1  atggcggcaa gtagccggtc tacccgaggt agaaagcagc gcggacgtag
      51  cgtggaagca aaatccagag ctattcgagc caacccgcct gtccctcgac
     101  ccaacccgca gcgaaaccgt cccccacctg cgggaacaac ctgctccatg
     151  tccgaaattc tgcttgcagt gtcagcaaca actgctgacc aaattctcga
     201  gattccagtg tgcgcaggga ttgacttccc agctggaacg ccaccccgat
     251  acattggggc ggccaaatgg ctggcagcac aatcacagat gtggaacaca
     301  attgtgttca actctgtgcg catcacttgg gaaacattca cagcagacac
     351  cactagcgga tacatctcca tggcattcct ctctgattac atgctatcaa
     401  tacccactgg ggtggaggat gttgccagga tcgtgccctc agctacaata
     451  gctctgaaga acagagggcc gtccattgtt atgccacaaa accgcactgt
     501  gttcaggtgc atacaggctg gtcagttcgc tgcgttgggc agcgcggctg
     551  acaagcaaat gtattccccc ggacgattca ttgtggctat ccccaaagct
     601  agtgcaacac aagcggtagg ccaaatcaaa atctcgtact ccgtgtccta
     651  ccgtggagca gcaatcctac aacctgccct ggttccaggc ccagggctgg
     701  caaatcattg a