Sequence of DPV Maize chlorotic mottle virus

Maize chlorotic mottle virus isolate Yunnan2, complete genome.

ACC No: JQ982468

Dated: 2012-07-22 | Length: 4436 | CRC: -858188279

ID   JQ982468; SV 1; linear; genomic RNA; STD; VRL; 4436 BP.
AC   JQ982468;
DT   22-JUL-2012 (Rel. 113, Created)
DT   22-JUL-2012 (Rel. 113, Last updated, Version 1)
DE   Maize chlorotic mottle virus isolate Yunnan2, complete genome.
KW   .
OS   Maize chlorotic mottle virus
OC   Viruses; ssRNA positive-strand viruses, no DNA stage; Tombusviridae;
OC   Machlomovirus.
RN   [1]
RP   1-4436
RA   Wang Q., Wu J., Hong J., Zhou X.;
RT   "Infectivity of Maize Chlorotic Mottle Virus on Zea mays";
RL   Unpublished.
RN   [2]
RP   1-4436
RA   Wang Q., Wu J., Hong J., Zhou X.;
RT   ;
RL   Submitted (26-APR-2012) to the INSDC.
RL   College of Agriculture and Biotechnolog, Zhejiang University, Institute of
RL   Biotechnology, 388#, Yu Hang Tang Road, HangZhou, ZheJiang 3100558, China
FH   Key             Location/Qualifiers
FT   source          1. .4436
FT                   /organism="Maize chlorotic mottle virus"
FT                   /host="Zea mays"
FT                   /isolate="Yunnan2"
FT                   /mol_type="genomic RNA"
FT                   /country="China:Yuanmou, Yunnan"
FT                   /collection_date="Oct-2009"
FT                   /PCR_primers="fwd_name: 5-f, fwd_seq:
FT                   aggtaatctgcggcaacagaccccaacg, rev_name: 3-r, rev_seq:
FT                   gggccggaagagaggggcattac"
FT                   /db_xref="taxon:12138"
FT   misc_feature    118. .987
FT                   /note="similar to P32"
FT   CDS             137. .3034
FT                   /codon_start=1
FT                   /transl_except=(pos:1451. .1453,aa:OTHER)
FT                   /product="P111"
FT                   /note="111kDa protein; read-through protein"
FT                   /protein_id="AFN69355.1"
FT   CDS             137. .1453
FT                   /codon_start=1
FT                   /product="P50"
FT                   /note="50 kDa protein; putative replicase"
FT                   /protein_id="AFN69356.1"
FT   CDS             2995. .3834
FT                   /codon_start=1
FT                   /transl_except=(pos:3199. .3201,aa:OTHER)
FT                   /product="P31"
FT                   /note="31kDa protein; read-through protein"
FT                   /protein_id="AFN69357.1"
FT   CDS             2995. .3201
FT                   /codon_start=1
FT                   /product="P7"
FT                   /note="7kDa protein"
FT                   /protein_id="AFN69358.1"
FT   CDS             3384. .4094
FT                   /codon_start=1
FT                   /product="coat protein"
FT                   /note="CP"
FT                   /protein_id="AFN69359.1"
FT                   LQPALVPGPGLANH"
SQ   Sequence 4436 BP; 1199 A; 1122 C; 1116 G; 999 T; 0 other;

jq982468 Length: 4436  22-JUL-2012  Type: N  Check: 1136  ..

       1  aggtaatctg cggcaacaga ccccaacgcg ctaaacacga ccttacagtt
      51  gactcacgtc ttgcatcctg tgagagcttt agcgtgggaa tttgcccctg
     101  actggcaatc aggtttcatg ccctctccgt gcacatatgg cgaccctacc
     151  ttcaattcac gcattttgga agctgtggtg gccgacgttc tcggaggaac
     201  ggaagatgac ggtggtccaa gccttgagga atggtttgac gcgcaaactc
     251  tttcagatta cacgaattgc gcaacagatc ctccgatggc caccgtacat
     301  acgcgagaga gtgacatcaa gtcttggacg gagcttagtg gaaactttcc
     351  agaccttgtt aggtatccgg aaagtcttgt cgaaactctg cttgacacgg
     401  aacatgaatg tggacatttt tacgatgctc ctgattcctt tcagatttct
     451  gtcacagcta tgttcacaga tcgttgcaag tgccaggcat gtgatccaga
     501  ctttcaagca cggtctctct cgcgggctct gcttggcccg ttgccggaat
     551  ccggagacga tgcggagtgg atggagcaag catacactcc agatgcagaa
     601  ttgttcgtca acgagcccac tgatgacccc attccaacca cagactgcaa
     651  gagacctatc caacccacat ggtctgtgga tgtctactcg aaacaagttg
     701  actcagactg ggggctcagt gattcaacaa acgtcacggt acgttcggct
     751  agcagttcgc ttctccctgc tggccgcggg ggcatatttt tcatgtgtcc
     801  tcgcccgaaa ggcattgaaa gagtatgtct acaggtggga gctaaaatcc
     851  gatcaagaac tcccaactcg ggaacagtca caaatctccc aggtggaaca
     901  ggctatggaa cagaatggag cgatgatggt tatgaaactc aatggtccga
     951  cggcccctat tctatccctt caggactgtc tgactaaaca cgttctggtt
    1001  ccagagattg tggacgaaga aggcacagtg acacagaaag agcagtccac
    1051  atttctcatc cgtgagtttg gccctgccgt cagaaaccta gtgaccctcg
    1101  caaaactaga attcggcggg attccaaaga aaaccactgc caacgaactc
    1151  acggtttggc ggttcctggt acggaagtgt gagcaagcaa atatgaatcc
    1201  aactgactcc cgtactgcca tttcaatggc cctgccatat gtgtttatgc
    1251  cgtgccgtac tgatgttgga agagcttcaa ttccactgcg tgatgaatcc
    1301  attgagatct gtcgccaata tcgcgcacaa tttgtggagg agacacccct
    1351  acggcgagta ttcaacaacc cactgagcgg aaaagcatgg cgcaattggg
    1401  ttaggcacct gggtgggctg gatgatccag ccctattcca ggagctgaaa
    1451  taggggtgtc ttgaagagtg gcttggggtg cagtctcggc gcacacgtgc
    1501  gcggcatccc aaactccgta gccactttaa agacacgaga cacaaaaccc
    1551  gcagagtgtt ccggattgca ggtttgggca acctgtatga atttggggtc
    1601  cacaacaact ctgcggttaa cctggaacgt ggactgatgg aacgagtatt
    1651  ttatgtgaaa aatgataagg gggaactcgt ttcatgccct gagccaatta
    1701  gtgggatatt ttggaaaaat ttgaagggat tcagaaatag cattgttcac
    1751  catgtgggac acagacatcc ggtgtcacga gagacgtttc tcgcttacta
    1801  tacagggcca aagcgcacca tgtatgagaa agcggtgaat tccctctacg
    1851  aaatgcctgt ctcatacgac gatgctaaac tgaaaacatt tgttaaagca
    1901  gaaaagatca atctcactaa gaaagctgat cctgtaccac gtgtgatcca
    1951  accccgtgct ccccggtaca atgtggaact gggtaggtat ttgagaccgg
    2001  ttgagcaccc aatctaccat gccatagaca agatttgggg tggtccgact
    2051  atcatgaaag gttactcggt tgaacagatt ggaagacaca tcgaaaacgc
    2101  gtttcgatcg ttcaccgatc cagtagccat tggatttgat gcaagtcggt
    2151  ttgatcaaca cgtgagtgtt gaagctctac gctgggaaca tagcgtatac
    2201  acaaggattt atggctatcc agagcttctc acacaattgc tgcggtggca
    2251  gattcacaat cgtggaacag catacgcttc agacggcgcg ttcaactacc
    2301  aggtggatgg taaacgcatg agtggagaca tgaacacatc attgggcaat
    2351  tgcatcctgg ccacagcaat cacacatgac ttcgtaacca agctgggaat
    2401  tccagccaga ttaatcaaca atggagatga caacgtcctg atctgtccgg
    2451  cagtggaggt aggcagagtc agacaggaac tgtacagaca ttggttgaac
    2501  tacggatttg aagtcatatc agaagaacct gtatacatcc ttgaacaggt
    2551  tgagttttgc cagatgcgac cagtctttga cggtacacaa tacaccatga
    2601  tgagagaccc acgcaccacc atgtccaagg atgcatatgc tgttacccct
    2651  tttaacacgc caaccgcagc aaggaggtgg atgagagcag ttggggaatg
    2701  cggactcagc cttacaggag gcctccccgt aaagcaggaa tactatgctg
    2751  ctctcgtgaa acacggacta gatccgaaaa acattaaaca gggaaaagac
    2801  tttgacagtg ggctatatta tcttagcaag ctatccaatc gcaaatggca
    2851  ggaggtccaa gagagcgctc gctactcatt ctggcttgct ttcgggtaca
    2901  caccagatga acaacgagcg ttagaggagt attttagatc ttggactcct
    2951  acgtttgaat ggtccacaac gggtattttg gcagaaatcc ccgaatgtct
    3001  tcttctcaaa cacaatcccc tcccaccgac gtagcccgca gacaacagac
    3051  cggcactgcc gtgcgatccg aagataacca tcgcaatcag ttggaaaaca
    3101  ttgctgttgg aaaactcacc aaatctgaag gagcacccgc ccaacagaac
    3151  gtgatcattg caaaagaggt ggttatcaat aaccacttca atttcaactg
    3201  agctggagtg tgtgtgtgta gaatcgtcct ggcctcagtg gttaaggaat
    3251  ttaatcttgg ggattttgat ctcctcgatt ctgttcatct tgacgaaaac
    3301  acaggacacc gttgccgttt atcacgagcc atcggtgtac tcgatcgatc
    3351  aaacgcaaaa attccaaaag atcgacatac acaatggcgg caagtagccg
    3401  gtctacccga ggtagaaagc agcgcggacg tagcgtggaa gcaaaatcca
    3451  gagctattcg agccaacccg cctgtccctc gacccaaccc gcagcgaaac
    3501  cgtcccccac ctgcgggaac aacctgctcc atgtccgaaa ttctgcttgc
    3551  agtgtcagca acaactgctg accaaattct cgagattcca gtgtgcgcag
    3601  ggattgactt cccagctgga acgccacccc gatacattgg ggcggccaaa
    3651  tggctggcag cacaatcaca gatgtggaac acaattgtgt tcaactctgt
    3701  gcgcatcact tgggaaacat tcacagcaga caccactagc ggatacatct
    3751  ccatggcatt cctctctgat tacatgctat caatacccac tggggtggag
    3801  gatgttgcca ggatcgtgcc ctcagctaca atagctctga agaacagagg
    3851  gccgtccatt gttatgcccc aaaaccgcac tgtgttcagg tgcatacagg
    3901  ctggtcagtt tgctgcgttg ggcagcgcgg ctgacaagca aatgtattcc
    3951  cccggacgat tcattgtggc tatccccaaa gctagtgcaa cacaagcggt
    4001  aggccaaatc aaaatctcgt actctgtgtc ctaccgtgga gcagcaatcc
    4051  tacaacctgc cctggttcca ggcccagggc tggcaaatca ttgagcataa
    4101  ggtgagccgg catgaggttg caagaccgga acaaccagtc cttctggcag
    4151  agccctgcca atccaaagtg tctgggagcc taaatcgtat actagtagtt
    4201  tgcgtgatga ccatgactgg agagtgggcg gcggctgcca accgcagact
    4251  gggcgtatat agtaagcctt gacccaccca tggaaaacac gtatttacga
    4301  acggtacgac atggtaactg gatacactta accctggggc aagtagatgc
    4351  taggaaacta gcatcgggcc gcccacgagg gtttctgaac tcaacggagt
    4401  agaacggggg ggggtaatgc ccctctcttc cggccc